Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Explain Sodium
Sodium (Nu) : In sodium-restricted diets, no salt is added to the diet which still provides approximately 50 mmoL Na. Foods containing high Na content must be avoided and the examples include processed or cured meats, tinned or smoked fish, tinned vegetables and soups, dehydrated and pre-packed meals, salted biscuits, nuts and crisps. There are very low Na diets as well which contain 20 mmoL Na.
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Hirudinea - Feeding and Digestion in Annelids Hirudinea involves free living and ectoparasitic leeches. Leeches are blood suckers. The digestive system contains a preoral cham
Proteins Protease inhibitors: Protease inhibitors are protein-based substances widely distributed within the plant kingdom, including the seeds of most cultivated legumes wh
Define the term Prebiotics? Dietary Sources and their Mode of Action/health Effects We have already seen how prebiotics are defined. Let us go a little in-depth about them. Pre
Eucaryotic cell structure All eucaryotic cells have a cytoskeleton made up of a network of protein filaments (Figure shown below). This network gives the cell its shape, capac
Define the symptoms in Bone marrow of pernicious anaemia? The nucleated red cells of the marrow are greatly increased. The successive nucleated cell stages in erythropoiesis a
egg of frog
In 1954, Public Health Service organized an experiment in that nearly 2 million children in grades 1, 2 and 3 participated. Experiment was to test a vaccine. Name the disease c
Q. Show Major complications of hypertension? High blood pressure is one of the leading causes of kidney failure, also commonly called end-stage renal disease (ESRD). Major
Choose the correct answer. A. The phenotype determines the genotype. B. True-breeding individuals are produced by repeated backcrossing. C. Recessive alleles are usually loss-of-fu
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd