Explain sodium, Biology

Assignment Help:

Explain Sodium

Sodium (Nu)  :  In  sodium-restricted diets, no salt  is added to the diet which still provides approximately 50 mmoL Na. Foods containing high Na content must be avoided and the  examples include  processed or cured meats,  tinned or smoked  fish, tinned vegetables and soups, dehydrated and pre-packed meals, salted biscuits, nuts and crisps. There are very  low Na diets as well which contain 20 mmoL Na.

 


Related Discussions:- Explain sodium

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Hirudinea - feeding and digestion in annelids, Hirudinea - Feeding and Dige...

Hirudinea - Feeding and Digestion in Annelids Hirudinea involves free living and ectoparasitic leeches. Leeches are blood suckers. The digestive system contains a preoral cham

Agro industrial-proteins, Proteins Protease inhibitors: Protease inh...

Proteins Protease inhibitors: Protease inhibitors are protein-based substances widely distributed within the plant kingdom, including the seeds of most cultivated legumes wh

Define the term prebiotics, Define the term Prebiotics? Dietary Sources...

Define the term Prebiotics? Dietary Sources and their Mode of Action/health Effects We have already seen how prebiotics are defined. Let us go a little in-depth about them. Pre

Eucaryotic cell structure , Eucaryotic cell structure All eucaryotic c...

Eucaryotic cell structure All eucaryotic cells have a cytoskeleton made up of a network of protein filaments (Figure shown below). This network gives the cell its shape, capac

Define the symptoms in bone marrow of pernicious anaemia, Define the sympto...

Define the symptoms in Bone marrow of pernicious anaemia? The nucleated red cells of the marrow are greatly increased.  The successive nucleated cell stages in erythropoiesis a

Describe polio, In 1954, Public Health Service organized an experiment in t...

In 1954, Public Health Service organized an experiment in that nearly 2 million children in grades 1, 2 and 3 participated. Experiment was to test a vaccine. Name the disease c

Show major complications of hypertension, Q. Show Major complications of hy...

Q. Show Major complications of hypertension? High blood pressure is one of the leading causes of kidney failure, also commonly called end-stage renal disease (ESRD).  Major

Loss-of-function mutations, Choose the correct answer. A. The phenotype det...

Choose the correct answer. A. The phenotype determines the genotype. B. True-breeding individuals are produced by repeated backcrossing. C. Recessive alleles are usually loss-of-fu

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd