Explain prodecures of antimicrobial prophylaxis, Biology

Assignment Help:

Antimicrobial prophylaxis

Antimicrobial prophylaxis is generally not indicated for cardiac catheterization, varicose vein surgery, most dermatologic and plastic surgery, arterial puncture, thoracentesis, paracentesis, repair of simple lacerations, outpatient treatment of burns, dental extractions or root canal therapy because the incidence of surgical site infections is low. A study in patients undergoing cosmetic procedures who did not receive prophylactic antibiotics found that infection was more common after longer operations; the authors concluded that a single dose of cefazolin might be helpful before operations that last more than 3 hours.

 


Related Discussions:- Explain prodecures of antimicrobial prophylaxis

Criteria to complete evolutionary branch of vertebrates, What are the six c...

What are the six criteria used to build a complete evolutionary branch of vertebrates? Dichotomy in each of the six following criteria builds the vertebrate evolutionary branch

Explain prophylaxis with antimicrobial, Explain Prophylaxis with antimicrob...

Explain Prophylaxis with antimicrobial Prophylaxis with antimicrobials has decreased the incidence of surgical site infection after head and neck operations that involve an inc

Give three examples of reflex actions, Give three examples of reflex action...

Give three examples of reflex actions. Examples of reflex actions are alter in size of the pupil of the eye in response to light intensity, blinking in response to foreign par

Define eye balling, Q. Define Eye Balling? Ans. Two-dimensional ec...

Q. Define Eye Balling? Ans. Two-dimensional echocardiography provides a good visual perception of cardiac functions. With experience, the echocardiologist learns to percei

Mitochondria be considered the power plants of the cell, Q. Why can mitocho...

Q. Why can mitochondria be considered the power plants of the aerobic cells? Mitochondria are the "power plants" of aerobic cells because within them the final stages of the ce

Aetiology, Aetiology:   A List Of The Causes Of A Disease  (Description Of ...

Aetiology:   A List Of The Causes Of A Disease  (Description Of The Characteristic Causes) Factors Which Influence The Onset Of Disease:  Include "Risk Factors", Life-Style, Sex, A

What is cerebrum, What is Cerebrum Cerebrum is divided into right and l...

What is Cerebrum Cerebrum is divided into right and left parts known as cerebral hemisphere. It is the largest part of the brain. The functions of the cerebrum:  It recei

Define effect of enery on quality and quantity of human milk, Define Effect...

Define Effect of Enery on quality and quantity of human milk? Energy: In case of chronic under nutrition, an association between postpartum weight loss and lower energy transfe

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain health care, Patient Care The primary basic principle in nutrit...

Patient Care The primary basic principle in nutritional practice to be valid must be person/patient- centered.  It must  be  based  on  initial and  continuing  identified  nee

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd