Explain pollination and its types, Biology

Assignment Help:

Q. What is the pollination? What are the major forms of pollination?

The procedure in which pollen grains (the male gametophytes of phanerogamic plants) reach the female gametophyte is called pollination.

The major forms of pollination are: anemophily, in which pollen is carried by wind. Hydrophily, pollination assisted by water; entomophily, pollen carried by insects; ornitophily, pollination by birds; chiropterophily, pollen dissemination by bats.

Features of the flowers of each plant species relate to the type of pollination used by the plant. Colored flowers are expertise in bird and insect attraction; nocturnal flowers in generally are white also perfumed, many specialized in pollination by bats; the nectar is also a specialization to attract pollinator animals; flowers that produce an exaggerated amount of pollen often use the wind as pollinator; the position of anthers more internal or external next to the nectar is a way to facilitate the pollen dissemination respectively by the wind or by animals.


Related Discussions:- Explain pollination and its types

What are the mitochondria, Q. What are the mitochondria? What is the fundam...

Q. What are the mitochondria? What is the fundamental morphology of these organelles and in which cells can they be found? Mitochondria are the organelles in which the most sig

Genetics what is this type of gene frequency change called, An hypothesis f...

An hypothesis for the extinction of the dinosaurs is that the earth had been hit by a gigantic meteor that caused the death of those big reptiles. In that case the entire genetic p

Define the meaning of goitrogens, Define the Meaning of Goitrogens? Goi...

Define the Meaning of Goitrogens? Goitrogens are substances that interfere with iodide metabolism in any way that inhibits thyroid hormone synthesis. As a result, there is augm

Associated foods with escherichia coli, Q. Associated Foods with escherichi...

Q. Associated Foods with escherichia coli? Associated Foods: E. coli is the etiologic agent of food poisoning involves variety of foods such as cream pie, mashed potatoes, cr

Systemic emboli, Osler's nodes are small, tender subcutaneous nodules that ...

Osler's nodes are small, tender subcutaneous nodules that develop in the pulp of the digits or occasionally more proximally in the fingers and persist for hours to several days. Th

Respiration – protozoan, Respiration – Protozoan Gas exchange occurs b...

Respiration – Protozoan Gas exchange occurs by the diffusion of oxygen across the cell membrane. Some protozoan utilize this oxygen but are also capable of anaerobic respirati

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Thalassemia, Thalassemia   Thalassemias are the commonest hemolytic ana...

Thalassemia   Thalassemias are the commonest hemolytic anaemias or disorder seen in children in India. This is characterised by deficiency  in the synthesis  of one of the norm

What is lysosomes, What is Lysosomes? Lysosomes :  Animal and fungal ...

What is Lysosomes? Lysosomes :  Animal and fungal cells contain membrane-bound organelles called lysosomes, which are filled with digestive enzymes. These digestive enzyme

Foods incriminated, Foods that are frequently incriminated in staphylococca...

Foods that are frequently incriminated in staphylococcal food poisoning include meat and meat products, poultry and egg products, egg, tuna, chicken, potato and macaroni, bakery pr

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd