Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Explain Oxygen Therapyin respiratory support?
Oxygen is given to correct hypoxemia. An initial high concentration of oxygen (FiO2) is given while the underlying cause is identified and corrected. The dangers of supplemental oxygen in patients with hypercarbic COPD has been exaggerated - in general, hypoxia is far more dangerous than hypercarbia and should be corrected as priority. The adverse effects of high concentrations of oxygen (oxygen toxicity) is also unimportant in a hypoxic patient. The key is to give as much oxygen as is required to correct hypoxia.
function of cell coat
Q. Classifications of mechanical cleaning devices? In general, three classifications of mechanical cleaning devices are available for the dental office. They are: ult
Title Legal aspects in obstetrical ultrasound Introduction Obstetric ultrasound is an essential component of antenatal care and it is widely perceived to be associated
xerophytes types
Explain the Autonomic neuropathy It leads to dry skin due to decreased sweating. Dryness of the skin leads to cracking which makes entry of infection in to the deeper plane eas
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Explain Doctrine of Signatures? Handed down from the ancients, and elaborated on by the herbalists, was the 'Doctrine of Signatures', which was based on features that resembled
A study is made to verify the effects of pesticide exposure on pupal weight of butterflies. In a pilot study, 5 randomly selected larvae are raised on plants exposed to the pestici
Define Health Benefits of Other Dietary Factors with Antinutritional Effects? Despite the predominantly nutritional antagonistic effects of the factors described above, there i
Define Surface properties of Proteins? The surface properties relates primarily to surface tension, emulsification and foaming characteristics of proteins, which are discussed
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd