Explain oxygen therapyin respiratory support, Biology

Assignment Help:

Explain Oxygen Therapyin respiratory support?

Oxygen is given to correct hypoxemia. An initial high concentration of oxygen (FiO2) is given while the underlying cause is identified and corrected. The dangers of supplemental oxygen in patients with hypercarbic COPD has been exaggerated - in general, hypoxia is far more dangerous than hypercarbia and should be corrected as priority. The adverse effects of high concentrations of oxygen (oxygen toxicity) is also unimportant in a hypoxic patient. The key is to give as much oxygen as is required to correct hypoxia.


Related Discussions:- Explain oxygen therapyin respiratory support

Classifications of mechanical cleaning devices, Q. Classifications of mecha...

Q. Classifications of mechanical cleaning devices? In general, three classifications of mechanical cleaning devices are available for the dental office. They are:  ult

Obstetric ultrasound , Title Legal aspects in obstetrical ultrasound  ...

Title Legal aspects in obstetrical ultrasound  Introduction Obstetric ultrasound is an essential component of antenatal care and it is widely perceived to be associated

Explain the autonomic neuropathy, Explain the Autonomic neuropathy It l...

Explain the Autonomic neuropathy It leads to dry skin due to decreased sweating. Dryness of the skin leads to cracking which makes entry of infection in to the deeper plane eas

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain doctrine of signatures, Explain Doctrine of Signatures? Handed ...

Explain Doctrine of Signatures? Handed down from the ancients, and elaborated on by the herbalists, was the 'Doctrine of Signatures', which was based on features that resembled

How many larvae per treatment, A study is made to verify the effects of pes...

A study is made to verify the effects of pesticide exposure on pupal weight of butterflies. In a pilot study, 5 randomly selected larvae are raised on plants exposed to the pestici

Health benefits of dietary factors - antinutritional effect, Define Health ...

Define Health Benefits of Other Dietary Factors with Antinutritional Effects? Despite the predominantly nutritional antagonistic effects of the factors described above, there i

Define surface properties of proteins, Define Surface properties of Protein...

Define Surface properties of Proteins? The surface properties relates primarily to surface tension, emulsification and foaming characteristics of proteins, which are discussed

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd