Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Explain Observation or Inference required for osazone test?
1. Crystals of different shapes will be seen. Glucose and fructose give needle shaped crystals and galactose gives flower shaped crystals.
2. Maltose and lactose possess a free sugar group and thus can combine with phenylhydrazine to give osazones of characteristic shapes. Osazones of maltose and lactose are soluble in hot water and separate out only on cooling.
3. Sucrose does not have any free sugar group and cannot form an osazone.
A "phosphodiester bond" links together: Answer the 3' hydroxyl group and the N9 atom of adenine in ATP. The Phosphate group and N9 atom of adenine in ATP. Sequential nucleosides in
B o v i ne viral diarrhoea Bovine viral diarrhoea (BVD) and mucosal disease (MD) are clinically dissimilar disease syndrome yet have a common viral etiology. The acute dise
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Explain the Impedance method to Measure Body Fats? Impedance method: This method can give entire body composition like total body water (TBW), fat free mass (FFM) or lean body
Q. What is structural formula of glycerol? To which organic function do these molecules belong? Glycerol is a linear chain of three carbons, the central carbon is bound to one
Explain about the primary protein derivatives? a) Proteins: These are the insoluble products which result from the incipient action of very dilute acids or enzymes. e.g. casein
Which of the below terms is used to describe the formation of fibrous tissue where it generally does not exist? Is it: a) Fibrosis b) Fibrogenesis c) Fibrositis d) Non
What do you understand by Dimorphic nuclei? Organization of the nuclear material typical of ciliates. There is always a single small micronucleus and either one large or many m
HISTORY OF CELL BIOLOGY Scientific knowledge grows with the development of new tools and techniques for studying various physical and biological processes. This is true also of t
Explain the role of Bones in human biology? Bone is covered by a tough outer membrane called the periosteum. The periosteum contains systems of capillaries that supply the bone
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd