Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Explain Lipoprotein (Lp(a) Excess ?
While cholesterol and triglycerides are important lipid risk factors, another lipoprotein factor called Lipoprotein (a) is thought to play a significant role especially in genetic predisposition to coronary artery disease. Lp (a) is a sub fraction of LDL but ten times more atherogenic, and its serum level is genetically determined. Being a dual pathogen influencing both atherosclerotic and thrombotic process, it is considered as a powerful independent risk factor for premature and extensive coronary disease. It is widely believed to be a biological marker for familial CAD, having the same significance as that of a history of premature CAD in the family.
The inherited serum levels of Lp(a) are not influenced by gender, diet, smoking, or other risk factors. The pathological effects of Lp (a) begin at a level of 20-30 mg/dl and are magnified in the presence of high LDL, low HDL or a high TCHDLc ratio, again highlighting the significance of lipid fraction interrelationship. There is a ethnic and genetic variability in the level of Lp(a). Indians have a higher level than other groups or races like Chinese or Japanese.
However there are no data showing that the decrease in Lp(a) levels is associated with a decrease in the incidence of Cardio-vascular or cerebro-vascular disease. The value of the routine screening for, and/or treating Lp(a) excess, is therefore still debatable. Even then Lp(a) levels should probably be taken into account impatient with CAD without established risk factors. The other factors should be rigorously modified or eliminated because, as has been seen, in hypercholesterolemia patients with increased Lp(a) levels, the decrease in LDL cholesterol levels is followed by neutralisation of the atherogenic potential of Lp(a).
If a cow develops a preference for eating white four o'clock flowers and ignoring pink and red four o'clock flowers, what type of selection is being demonstrated? Would the cow eve
Explain the Theory or Principle for Determination of Fungal and Yeast Count? Fungi are widespread and present on food, equipments and processing and storage facilities. These a
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Define Intermediary Metabolites of an Athletes? Coenzyme Q10 - for the physically active; Co-Q 10 activates cell energy. While you carry out any physical act; run, jump, throw,
classification of virus
What is Micro-Endodontic Surgery? Combines of the magnification and illumination provided by the microscope with proper use of new micro-instruments.
diagram of phyllum protozoa
Q. Conditions Necessary for Outbreak of staphylococcal food? The following conditions are necessary for an outbreak of staphylococcal food poisoning: 1. The food must conta
separation of nucleic acid
Proteases of animals From the table you can see that these exopeptidases and endopeptidases attack specific peptide bonds depending on the chemical group near them. The inacti
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd