Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Explain Keshan disease caused by Selenium deficiency?
It is a cardiomyopathy (disease of the myocardium, involving heart muscle) that was identified to affect children and women of child bearing age in China. Sudden onset of insufficient heart function is characteristic of the acute form of this disease while in chronic Keshan disease, heart enlargement and insufficiency exist. Intervention trials comprising more than a million subjects in China has demonstrated the protective effect of selenium against Keshan's disease. It is important to note that selenium supplements cannot however reverse cardiac failure if it has occurred.
How does the absence of a nuclear envelope in prokaryotes prevent prokaryotes from controlling gene expression by modifying RNA after transcription? Without a nuclear envelope
Q. Which are the beings that form the kingdom Fungi? The kingdom Fungi is created by fungi. Q. Which are the beings that form the kingdom Plantae? Are algae parts of this k
Q. Into which type of energy is the light used in photosynthesis transformed? The luminous energy used in the photosynthesis is transformed in to the chemical energy.
Explain the Principle or Theory of biuret method? If a strongly alkaline solution of Biuret is heated with very dilute copper sulphate, a violet colour is obtained. The substan
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Explain how the uterus supports the development of a baby during gestation
What is Gymnosperms explain its dividions? Gymnosperms are one of the two major groups of plants that bear seeds. The other group, the Angiosperms (flowering plants), differ in
What are the main functions of the blood? The blood is a means of substance transportation all by the body. The blood distributes nutrients, oxygen, antibodies, hormones, and c
Q. What is Constrictive pericarditis? Constrictive pericarditis is the sequelae of chronic fibrosis and thickening of the pericardium as a result of chronic inflammation. E
Assessment of Peripheral Vascular Disorders History Obtain the following information by interviewing the patient and family members Previous vascular surgery, previ
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd