Explain keshan disease caused by selenium deficiency, Biology

Assignment Help:

Explain Keshan disease caused by Selenium deficiency?

It is a cardiomyopathy (disease of the myocardium, involving heart muscle) that was identified to affect children and women of child bearing age in China. Sudden onset of insufficient heart function is characteristic of the acute form of this disease while in chronic Keshan disease, heart enlargement and insufficiency exist. Intervention trials comprising more than a million subjects in China has demonstrated the protective effect of selenium against Keshan's disease. It is important to note that selenium supplements cannot however reverse cardiac failure if it has occurred.


Related Discussions:- Explain keshan disease caused by selenium deficiency

How does the absence of a nuclear envelope in prokaryotes, How does the abs...

How does the absence of a nuclear envelope in prokaryotes prevent prokaryotes from controlling gene expression by modifying RNA after transcription? Without a nuclear envelope

Which are the beings that form the kingdom plantae, Q. Which are the beings...

Q. Which are the beings that form the kingdom Fungi? The kingdom Fungi is created by fungi. Q. Which are the beings that form the kingdom Plantae? Are algae parts of this k

Which type of energy is used in photosynthesis transformed, Q. Into which t...

Q. Into which type of energy is the light used in photosynthesis transformed? The luminous energy used in the photosynthesis is transformed in to the chemical energy.

Explain the principle or theory of biuret method, Explain the Principle or ...

Explain the Principle or Theory of biuret method? If a strongly alkaline solution of Biuret is heated with very dilute copper sulphate, a violet colour is obtained. The substan

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Fertilisation, Explain how the uterus supports the development of a baby du...

Explain how the uterus supports the development of a baby during gestation

What is gymnosperms explain its dividions, What is Gymnosperms explain its ...

What is Gymnosperms explain its dividions? Gymnosperms are one of the two major groups of plants that bear seeds. The other group, the Angiosperms (flowering plants), differ in

What are the main functions of the blood, What are the main functions of th...

What are the main functions of the blood? The blood is a means of substance transportation all by the body. The blood distributes nutrients, oxygen, antibodies, hormones, and c

What is constrictive pericarditis, Q. What is Constrictive pericarditis? ...

Q. What is Constrictive pericarditis? Constrictive pericarditis is the sequelae of chronic fibrosis and thickening of the pericardium as a result of chronic inflammation. E

Assessment of peripheral vascular disorders - history, Assessment of Periph...

Assessment of Peripheral Vascular Disorders History Obtain the following information by interviewing the patient and family members Previous vascular surgery, previ

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd