Explain dietary management, Biology

Assignment Help:

Dietary Management

The golden  rule  in  the dietary  management  of  ally  fever  is  "feed  the fever". Considering that  enteric (typhoid) fever  is accompanied by anorexia, vomiting and high grade  temperature, the diet has  to  be modified as per  the patients'  tolerance. The patient  needs  to be encouraged to  eat. Feeding several  times  a  day improves tolerance. The  texture  01  foods given would  depend  on  the  severity  of  infection. Bland, low fibre and soft foods are beneficial.

 


Related Discussions:- Explain dietary management

Define proteins as structural elements and structural units, Define Protein...

Define Proteins as Structural Elements and Structural Units? The liver cell membrane analysis shows that this membrane contains 50-60% protein, 35% lipids and 5% carbohydrates.

Explain the techniques of operation in post myocardial, Explain the Techniq...

Explain the Techniques of Operation used in post myocardial infarction ventricular septal defect? Normal 0 false false false EN-IN X-NONE X-NONE

What is the vacuum puff drying, What is the Vacuum Puff Drying? The vac...

What is the Vacuum Puff Drying? The vacuum puff process has been developed for drying liquids under vacuum. The development of processes for drying liquids under vacuum came fr

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain about the ocular haemodynamics, Explain about the Ocular Haemodynam...

Explain about the Ocular Haemodynamics. The pressure in the ocular arteries can be measured by optical ophthalmodynamometer. The intraocular pressure is raised to the level tha

Explain the lingual nerve and artery, Lingual nerve and artery It is th...

Lingual nerve and artery It is the branch of mandibular nerve which enters the oral cavity above the posterior edge of the mylohyoid muscle close to the 3 rd molar region proc

Common causes related with angina pectoris, Q. Common causes related with a...

Q. Common causes related with angina pectoris? • The usual cause of angina is the narrowing of the major coronary artery due to atherosclerosis. • Systemic hypertension inc

Active or moderately active lifestyles - physical activity, Define Active o...

Define Active or moderately active Lifestyles - physical activity? These people have occupations that p-e not strenuous in terms of energy demands, but involve more energy expe

Catalogue of larval forms in various animal groups, Catalogue of Larval For...

Catalogue of Larval Forms in Various Animal Groups The larval stages and types found in different groups are many. Each larval type has a different structure and is known by a

What are the two main types of endocytosis, What are the two main types of ...

What are the two main types of endocytosis? Endocytosis can be divided as pinocytosis or phagocytosis. In pinocytosis small particles on the external surface of the membrane ex

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd