Define the mechanism of evolution, Biology

Assignment Help:

A few statements about the mechanism of evolution are made. Mark the correct statements.

 

(i)  Evolution happens at the individual level as well as population level.

(ii) As changes in the gene pool occur, a population evolves.

(iii) Mutation is the driving force of evolution and it leads to change in a gene pool of population.

(iv) Genetic drift is the change in the gene pool that occurs in a small population because of adaptation. 

(v) Assortative mating can cause an enhance in homozygous individuals and changes the allele frequencies in the population.

 

a.  (i)  and (ii)

b.  (ii) and (iii)

c.  (i), (iv) and (v)

d.  (i), (ii), (iii) and (v)

 


Related Discussions:- Define the mechanism of evolution

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Phylem porifera, please give us this phylem''s example...

please give us this phylem''s example...

Engler and prantls system of classification, Q. Engler and Prantl's System ...

Q. Engler and Prantl's System of Classification? Adolf Engler, Professor of Botany, University of Berlin, Germany, proposed a phylogenetic system of classification in a book en

Nutrient requirement during angina pectoris, Q. Nutrient requirement during...

Q. Nutrient requirement during angina pectoris? The nutrient requirement here is the same as discussed earlier, however, to sum up it can be said that we need to restrict calor

Discuss refractive and response to wound functions of cornea, Discuss the r...

Discuss the refractive and response to wound functions of cornea. Refractive Function: Cornea, through its interaction with the tear film, forms a smooth refractive functi

Bacterial growth medium, how a simple medium can be converted into selecti...

how a simple medium can be converted into selective differential and enriched medium?

Explain brifly ribosomes- endoplasmic reticulum , Explain brifly Ribosomes,...

Explain brifly Ribosomes, Endoplasmic Reticulum, Golgi Apparatus ? Ribosomes, Endoplasmic Reticulum, Golgi Apparatus :  The cytoplasm contains many ribosomes, which are sphe

Leukemia and explain why each finding occurs in this disease, Patient is a ...

Patient is a 7-year-old girl who was brought to her physician by her mother with complaints of general fatigue, anorexia, and unexplained bruises and "rash" for the past 2 weeks. C

Why does the ingestion of vegetable fibers improve the bowel, Why does the ...

Why does the ingestion of vegetable fibers improve the bowel habit in people that suffer from hard stools? Some types of plant fibers are not absorbed by the intestine but play

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd