Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Algae
Advantages
a) Produces proteins which have almost all the Essential Amino acids.
b) Rich in tyrosine and serine, low in sulphur containing amino acids.
Disadvantages
a) If the more than 100 gm of proteins are consumed, it may cause nausea, vomiting, abdominal pain etc. because of the cellulosic cell wall, which is not digestible in human subjects.
Applications : The first operation conducted was ligation of a patent ductus arteriosus through a left thoracotomy. Same approach is used for repair of coarctation of the aorta,
What is the cell division process directly related to the embryonic growth? The embryonic growth depends directly on mitosis. By this type of cell division the zygote separates
INTERNA L EAR - It is called membranous labyrinth protected by bonny labyrinth of periotic bone (Frontal, Temporal and Parietal). Between internal ear and bonny la
Explain Systemic Circulation in human biology? In systemic circulation, oxygenated blood is pumped from the left atrium through the bicuspid valve, into the left ventricle, and
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Failure to organize proper adjusting entries causes net income and the balance sheet to be in error. Using Micro Train Company as an instance this section has discussed and illustr
M e t h ods of curing Curing ingredients are applied in dry form or as a solution of curing ingredients in water (pickle or brine). The combination cure is applied in the i
What is the meaning of Visuoperceptive disorders It relates to the way in which brain damage impairs people's ability to adapt to the visual world and the concepts used to trea
TRACHE A - It is a thin walled tube. Situated on ventral side. Commonly known as wind pipe. Supported by C-shaped cartilagenous rings. Incomplete dorsally due to oesopha
Define about the Deficiency of cyanocobalamin? Malabsorption of vitamin B 12 can occur at several points during digestion. By far, the most important condition resulting in v
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +1-415-670-9521
Phone: +1-415-670-9521
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd