Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Effect on Water Bodies - Dissolved Oxygen (DO)
Most aquatic, organisms respire with oxygen dissolved in water. The quantity of dissolved oxygen in a unit volume of aerated water is only .0084g which is about one thirtieth of that present in the same volume of air at 25°C. The quantity decreases further with the increase of temperature. Hence the availability of oxygen is one of the critical factors for the survival of aquatic species. The amount of oxygen gas dissolved in a given quantity of water at a particular temperature and atmospheric pressure is referred to as DO and generally expressed as parts per million (ppm). DO in natural water is influenced by
Discharge of sewage in large quantities results in a drop in DO because decomposer organisms use up a lot of dissolved oxygen in decomposing organic matter. The water containing DO below 8 ppm is considered polluted. The gravely polluted water has DO below 4 ppm to nil. Volume and flow of water also affect biodegradation because consumed oxygen is rapidly renewed in large flowing water, whereas in stagnant water biodegradation is sharply reduced particularly in summer due to decrease in DO.
Medical status of the patient Conditions like osteoporosis, history of radiotherapy, use of bisphosphonates which can affect the success of the treatment should be considered b
Q. What are the major biological processes in which calcium participates? Calcium is present in approximately all cells and has various functions. Calcium has an significant ro
What is diffusion? Diffusion is the spreading of substance molecules from a region where the substance is more concentrated to another region where it is less concentrated. For
Which of the following is not a difference among DNA primase and DNA polymerase? A. DNA primase can initiate replication of DNA de novo whereas DNA polymerase needs a short oli
what websites can i use to modify my client''s meals?
Archaeological Records of Human Campsites Archaeological records of human campsites indicate that early humans started out as small bands of hunters who supplemented kills wit
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
how can i get an demo assignment to solve?
Define Heart Rate (HR) Method - aerobic capacity? An alternative method for determining aerobic capacity involves the measurement of heart rate. Heart rate is linearly associa
How do you determine net atp production after complete oxidation to CO2 and H2O using mitochondrial ?-oxidation, the TCA cycle, the mitochondrial electron transport chain and oxida
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd