Effect of air pollution, Biology

Assignment Help:

(i)    Effect on Human Health:

Air pollution causes many respiratory problems in human being.

(1)   Dust, soot and smog causes several respiratory troubles such as bronchitis, asthma, emphysema, lung cancer.

(2)   Fly ash and metal dusts causes headache, anemia, dizziness, insomnia etc.

(3)   SO2 causes drying of mouth, sore throat, eye irritation. It may damage the tissues by forming H2SO2.

(4)   NO and CO combine with hemoglobin of blood and reduces oxygen carrying capacity of blood.

(5)   Air borne organic material such as bacteria, a fungus etc. causes several diseases and allergic reactions or hay fever.

(6)    In atmosphere ozone is formed by photochemical reaction in stratosphere, which protects life on earth from high energetic U.V. radiation. In lower atmosphere, it produces chest pain, coughing and eye irritation.

(7)    Depletion of ozone layer exposes the earthy to increased U.V. radiations, which have caused increased rate of skin cancer and genetic mutation.

(8)    PAN (Peroxyacylnitrate) causes acute eye irritation.

(9)   Many hydrocarbons induce cancer. Tobacco smoke contains a hydrocarbon called benzopyrene, which causes lung cancer.

 

(ii) Effects on Animals:

The effects of air pollution on animals in and around industrial area are similar to those on human beings.

(1)        Ingestion of fluorine compounds deposited on fodder causes Fluor sis (Excessive calcification of bones and teeth). It is also causes of lameness, diarrhea and loss of weight.

(2)        Lead poisoning causes bronchitis and loss of appetite.

(3)        Many air borne microbes cause disease.

 

(iii) Effects on Plants:

Air pollution causes wide spread damage to plants.

(1)    Particulate such as dust, fog, soot get deposited on plant leaves, and retards photosynthesis.

(2)    Exposure of plant to high level of ozone causes chlorosis i.e. yellowing of green leaves.

(3)    Many plants are sensitive to PAN in smog which reduces photosynthesis and adversely effects cellular metabolism.

(4)    SO2 causes chlorosis, plasmolysis and membrane damage.

(5)    Ethylene (Hydrocarbon) causes premature leaf fall, fruit dropping, shedding of floral buds, curling of petals and discoloration of sepals.

(6)    Polluted air causes inhibited growth and death of lichens and it is an indicator of polluted area.

(7)    Terrestrial and aquatic vegetation is severely affected by acid rain.

 

(iv) Effects on Climate:

Earth climate depends on various factors one of them is composition of atmosphere and balance of gases. Therefore air pollution brings about harmful effects on climate.

(1)   Increase in CO2 will enhance the temperature of earth, (green house effects) resulting in melting of polar ice caps and glaciers etc.

(2)   Aerosols and nitrogen oxide depletes ozone layer in stratosphere which causes harmful U.V. radiation to reach on earth.

(3)   Changing regional climate may alters forests, crop fields and water supplies.


Related Discussions:- Effect of air pollution

Special uses of biogas, S p e c i a l Uses Biogas Biogas is an im...

S p e c i a l Uses Biogas Biogas is an important renewable energy resource for rural areas. Generation of bio-gas from dung and urine is a very simple and cost-effective

Failure of public production, Normal 0 false false false ...

Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4

Vesicular exanthema, Vesicular exanthema Vesicular exanthema of pigs close...

Vesicular exanthema Vesicular exanthema of pigs closely resembles foot-and-mouth disease in these animals. The virus causing the disease belongs to the genus Calicivirus in the fa

Define reagents required and methodology for mucic acid test, Define Reagen...

Define Reagents Required and Methodology for Mucic Acid Test? -   Sugar solution -   Conc. Nitric acid Methodology Take about 50 mg of sugar in a test tube. Add 1 ml

Define nutritional availability - microbial survival, Define Nutritional Av...

Define Nutritional Availability - Microbial Survival and Growth? Food borne microbes are chemotrophs. Generally the types of microorganisms present on a particular food are the

Illustrate about the term- hypnagogic hallucinations, Illustrate about the ...

Illustrate about the term- Hypnagogic hallucinations  Hypnagogic hallucinations (Greek, 'hypnos' meaning "sleep," and 'gogic' meaning "enter into") are episodes of auditory, vi

Unitary explanation for protein synthesis, Q. Why is the concept of a singl...

Q. Why is the concept of a single gene as ultimateunit of inheritance inadequate to provide a unitary explanation for protein synthesis, recombination and mutation? Answer:

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Fission - asexual reproduction, Normal 0 false false false ...

Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd