Discuss about sarcoplasmic reticulum, Biology

Assignment Help:

A healthy skeletal muscle fiber is isolated and has no external forces on it.  It has normal intracellular levels of ATP and is bathed in physiological saline.  Which of the following will lead to an increase in the overlap between thin and thick filaments in the muscle fiber?

A. An increase in the amount of binding of ACh to the muscarinic Acetylcholine Receptors (mAChRs) on the surface of the skeletal muscle.

B. An increase in the calcium conductance of the membranes of the sarcoplasmic reticulum.

C. an increase in the amount of calcium ions bound to actin.

 


Related Discussions:- Discuss about sarcoplasmic reticulum

Explain law of segregation, Which of the below terms laws best describes th...

Which of the below terms laws best describes the statement: Members of a homologous (pron: ho-MOL-eh-gus) pair of genes are separated at the time of meiosis (pron: my-O-sis) o

Is reproduction in sponges asexual or sexual, Q. Is reproduction in sponges...

Q. Is reproduction in sponges asexual or sexual? Reproduction in sponges can be asexual by budding, fragmentation or gemmation (regeneration) or sexual with larval stage a cili

Types of development of animals, Types of Development of Animals Diffe...

Types of Development of Animals Different animals have evolved various methods of development. These methods can be broadly categorized into two categories (i) Direct devel

Treatment of sewage, The sewage treatment methods can be classified into th...

The sewage treatment methods can be classified into the following heads: Primary treatment Secondary treatment Tertiary treatment 1. Primary Treatment: The primary

Formation of double bonds, In eukaryotes  the SER has enzymes  able to begi...

In eukaryotes  the SER has enzymes  able to begin  double  bonds into fatty acyl CoA molecules  in an oxidation  reaction  which uses molecular  oxygen.  This reaction is catalyzed

Meiosis, Meiosis is the special type of cell division in which the numbers ...

Meiosis is the special type of cell division in which the numbers of chromosomes in daughter cell are reduced to half, as compared to parent cell. Occurrence: It takes place

Explain the importance the relationship of structure, Explain the importanc...

Explain the importance of understanding the relationship between structure and function?

Sexual reproduction, Normal 0 false false false EN-IN ...

Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Phylum platyhelmenthiese, show heading wise characteristics of phylum platy...

show heading wise characteristics of phylum platyhelmenthiese

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd