Digestive system in cockroach, Biology

Assignment Help:

DIGESTIVE SYSTEM IN COCKROACH

ALIMENTARY CANAL

6-8 cm. long. Coiled, present from mouth to anus.

Differentiated into 3 parts -      1. Foregut            2. Midgut        3. Hindgut

1982_digestive system of cockroach.png

1.      FOREGUT

  1. Differentiated into pharynx, oesophagus, crop and gizzard.
  2. Pharynx is small tube like, present in neck.
  3. Pharynx is attached to oesophagus in thorax.
  4. Oesophagus forms crop (a sac like) upto 4th segment of abdomen.
  5. In crop food is stored & complete digestion takes place.
  6. At the base of crop gizzard or proventriculus present. Helpfull in grinding of food.
  7. Anterior part of gizzard is armarium, in it 6 denticles present made up of cuticle.
  8. Posterior part of gizzard is stomodeum in which 1 pair hairy pad pulvillus & 1 pair stomodeal valve present, allow only finnest particles of food.

2.      MID GUT

  1. Walls are soft and glandular. Starting point of mid gut is cardia.Digestion and absorption takes place in it.
  2. At the junction of mid gut and foregut 8 Hepatic ceacae present, secrete digestive juice that do digestion in crop.
  3. Secretion of stomodeal valve (Cardia) in mid gut forms peritrophic membrane around food to protect wall of mid gut.

3.      HIND GUT

  1. Differentiated into Iluem, colon & rectum.
  2. In ileum 6 spicules present function as sphinctor & tear off the peritrophic membrane.
  3. In colon undigested food is converted into faeces.
  4. In rectum on external surface 6 rectal ridges present alternate with 6 rectal pads on inner side.
  5. Maximum water is reabsorbed. Rectum opens outside by anus in 10th segment.
  6. Anus is controlled by 4 podical plates.

Related Discussions:- Digestive system in cockroach

Ways in which genetic recombination occurs during meiosis, Define two ways ...

Define two ways in which genetic recombination occurs during meiosis. Genetic recombination happens during crossing- over and independent assortment.

Ecological adaptations in animals to desert environment, Ecological adaptat...

Ecological adaptations in animals to desert environment In response to scarcity of water, animats adcipt vario6s strategies to conserve or prevent loss of water. Most of the de

What are the major cellular features of fungi, Q. What are the major cellul...

Q. What are the major cellular features of fungi? There are pluricellular and unicellular fungi. All fungi are heterotrophs and eukaryotes. Fungi have cells with cell wall m

Essential and non – essential amino acids, Essential and Non – Essential Am...

Essential and Non – Essential Amino Acids The requirement of essential amino acids differs from organism to organism. Some bacteria require only one amino acid in sufficient q

Which hormone secreted by the growing ovarian follicles, Q. What is the hor...

Q. What is the hormone secreted by the growing ovarian follicles? What is the action of that hormone upon the uterus? The follicles that are growing after menses secrete estrog

What does radial symmetry means, Q. What does radial symmetry means? What i...

Q. What does radial symmetry means? What is the kind of symmetry found in chordates? Which are other phyla of the animal kingdom that present species with radial symmetry? Radi

What proportion of children with down syndrome, What proportion of children...

What proportion of children with Down syndrome do you expect when women with down syndrome have children with men who have 46 chromosomes Justify your answer

Explain about the family and social history - assessment, Explain about the...

Explain about the Family and Social History - Assessment  Recent studies suggest that genetic variation plays an important role in etiology of learning problems. Hence, the col

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd