Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
DIGESTIVE SYSTEM IN COCKROACH
ALIMENTARY CANAL
6-8 cm. long. Coiled, present from mouth to anus.
Differentiated into 3 parts - 1. Foregut 2. Midgut 3. Hindgut
1. FOREGUT
2. MID GUT
3. HIND GUT
Define two ways in which genetic recombination occurs during meiosis. Genetic recombination happens during crossing- over and independent assortment.
Ecological adaptations in animals to desert environment In response to scarcity of water, animats adcipt vario6s strategies to conserve or prevent loss of water. Most of the de
Q. What are the major cellular features of fungi? There are pluricellular and unicellular fungi. All fungi are heterotrophs and eukaryotes. Fungi have cells with cell wall m
Essential and Non – Essential Amino Acids The requirement of essential amino acids differs from organism to organism. Some bacteria require only one amino acid in sufficient q
Q. What is the hormone secreted by the growing ovarian follicles? What is the action of that hormone upon the uterus? The follicles that are growing after menses secrete estrog
Q. What does radial symmetry means? What is the kind of symmetry found in chordates? Which are other phyla of the animal kingdom that present species with radial symmetry? Radi
What proportion of children with Down syndrome do you expect when women with down syndrome have children with men who have 46 chromosomes Justify your answer
Explain about the Family and Social History - Assessment Recent studies suggest that genetic variation plays an important role in etiology of learning problems. Hence, the col
Change in nucleus during cleavage
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd