Define about the geriatric nutrition, Biology

Assignment Help:

Define about the Geriatric Nutrition?

Aging has been defined as "a series of time related process that ultimately brings life to a close." Persons of 60 years of age and older are defined as elderly by WHO M. Successful aging is said to be multidimensional and has been defined as "encompassing the avoidance of disease and disability, maintenance of cognitive and physical function and sustained social and productive activity.

By 2020, around 13% of global population (1 billion people) would be above 60 years of age. It is expected that 1/3rd of this total population will be in developing countries.  The increment being approximately 3% per year in developing countries and 1% per year in developed countries. It is important that the elderly live a healthy and functional life than live with chronic disabilities. Since elderly are more susceptible to chronic  and degenerative problems it would be interesting to know more about the physical  and physiological changes linked with aging.


Related Discussions:- Define about the geriatric nutrition

State the study of linked genes, Why is drosophila a convenient animal for ...

Why is drosophila a convenient animal for the study of linked genes? The fruit fly drosophila is suitable for the study of Genetics because it shows many distinct traits but on

Tissue culture, Note on production of haploid by tissue culture.

Note on production of haploid by tissue culture.

What is barfoed test and explain its principle, What is Barfoed's test and ...

What is Barfoed's test and its principle? This test is a specific test for monosaccharides. Principle This test is also a copper reduction test but differs from Fehling

Are there differences between the male and female skeletons, Q. Are there d...

Q. Are there differences between the male and female skeletons? Many general differences exist between female and male skeletons. Male skeleton is normally larger and heavier t

Possible errors in drug administration, POSSIBLE ERRORS IN DRUG ADMINISTRAT...

POSSIBLE ERRORS IN DRUG ADMINISTRATION There can be various reasons for error in administering drugs: i) Poor communication of intention by the prescriber. ii) Failur

Anti-diuretic hormone, who discovered it? and what is it''s physiologic fun...

who discovered it? and what is it''s physiologic functions?

Explain post-lyme disease syndrome, Explain Post-lyme disease syndrome  ...

Explain Post-lyme disease syndrome  Some treated patients whose objective manifestations of Lyme disease have resolved with antibiotic treatment report subjective symptoms suc

Define role of thiamin in the conversion carbohydrate to fat, Define the Ro...

Define the Role of Thiamin in the conversion carbohydrate to fats? Thiamin helps in the initial steps of fatty acid and sterol production. In this way, thiamin also helps co

The human impact on the environment, what are the principle sources of exce...

what are the principle sources of excessive nitrate and phosphate in rivers and lakes?

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd