Difference between the exocrine and endocrine gland, Biology

Assignment Help:

Q. What is the difference between the exocrine gland and the endocrine gland?

Endocrine gland is a gland whose secretions are called as hormones that are collected by the blood and reach the tissues through the circulation. The adrenals and the hypophysis (pituitary) are examples of endocrine glands. Exocrine gland is a gland whose secretions are released externally through ducts into the skin, intestinal lumen, mouth, and so on. The sebaceous glands and the salivary glands are instances of exocrine glands.


Related Discussions:- Difference between the exocrine and endocrine gland

Define water output (losses of body water) - renal loss, Define Water Outpu...

Define Water Output (Losses of body water) - Renal loss? Water is lost from the body by the four routes, namely kidneys (renal system), skin, lungs and intestine. Let us discus

When to use the term 2'' carbon, When do you use the term 2' carbon and whe...

When do you use the term 2' carbon and when do you use 2 carbons on a molecular structure? I need examples please!

Explain the term - diffusion, Explain the term-Diffusion Diffusion occu...

Explain the term-Diffusion Diffusion occurs from the side of greater concentration to the side of lesser concentration. In aqueous humour this occurs from the plasma side in th

What treatment should be used for constrictive pericarditis, Q. What treatm...

Q. What treatment should be used for constrictive pericarditis? Medical Treatment 1) Judicious use of diuretics to alleviate systemic congestion. This may be enough in s

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

photosynthesis: light energy to synthesize , Photosynthesis happens in alg...

Photosynthesis happens in algae, green plants and photosynthetic bacteria. Its part is to catch solar energy and use this to drive the synthesis of carbohydrate from water and carb

Hydropower, Energy from water or hydropower            Hydroelectrici...

Energy from water or hydropower            Hydroelectricity is the energy produce from the kinetic energy of water falling from height. Approximately 25% of world electricity

Explain the recommended dietary allowances - nutrition, Explain the Recomme...

Explain the Recommended Dietary Allowances - Nutrition? RDA: The RDA is the average daily dietary intake that is sufficient to meet the nutrient requirement of nearly all healt

Digestive system in planarias, Q. How are nutrients distributed through the...

Q. How are nutrients distributed through the digestive system in planarias? Planarias have single opening digestive system incomplete with ramifications that transport nutrient

Oxidation reduction potential, what exactly is oxidation and reduction pote...

what exactly is oxidation and reduction potential and how its an imp. factor in spoiling meat

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd