Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Q. What is the difference between the exocrine gland and the endocrine gland?
Endocrine gland is a gland whose secretions are called as hormones that are collected by the blood and reach the tissues through the circulation. The adrenals and the hypophysis (pituitary) are examples of endocrine glands. Exocrine gland is a gland whose secretions are released externally through ducts into the skin, intestinal lumen, mouth, and so on. The sebaceous glands and the salivary glands are instances of exocrine glands.
Define Water Output (Losses of body water) - Renal loss? Water is lost from the body by the four routes, namely kidneys (renal system), skin, lungs and intestine. Let us discus
When do you use the term 2' carbon and when do you use 2 carbons on a molecular structure? I need examples please!
Explain the term-Diffusion Diffusion occurs from the side of greater concentration to the side of lesser concentration. In aqueous humour this occurs from the plasma side in th
Q. What treatment should be used for constrictive pericarditis? Medical Treatment 1) Judicious use of diuretics to alleviate systemic congestion. This may be enough in s
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Photosynthesis happens in algae, green plants and photosynthetic bacteria. Its part is to catch solar energy and use this to drive the synthesis of carbohydrate from water and carb
Energy from water or hydropower Hydroelectricity is the energy produce from the kinetic energy of water falling from height. Approximately 25% of world electricity
Explain the Recommended Dietary Allowances - Nutrition? RDA: The RDA is the average daily dietary intake that is sufficient to meet the nutrient requirement of nearly all healt
Q. How are nutrients distributed through the digestive system in planarias? Planarias have single opening digestive system incomplete with ramifications that transport nutrient
what exactly is oxidation and reduction potential and how its an imp. factor in spoiling meat
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd