Difference between hemoglobin and oxyhemoglobin, Biology

Assignment Help:

Q. How different are hemoglobin and oxyhemoglobin?

Where is it expected to find a higher concentration of oxyhemoglobin, in peripheral tissues or in the lungs?

Oxygen-bound hemoglobin is called as oxyhemoglobin in the lungs the oxygen concentration is higher and so there is a higher oxyhemoglobin concentration. In the peripheral tissues the situation is the reverse the concentration of oxygen is lower and there is more free hemoglobin.


Related Discussions:- Difference between hemoglobin and oxyhemoglobin

Describe methods of diagnosing chromosome abnormalities, Explain the differ...

Explain the difference between numerical chromosome abnormalities and single gene disorders. Describe methods of diagnosing chromosome abnormalities prenatally and after birth. How

Main source of energy for living beings on earth, Q What is the main source...

Q What is the main source of energy for living beings on earth? The sun, center of our planetary system and star of the Milky Way galaxy (our galaxy), is the source of the ener

Hormones secreted by the thyroid gland, Q. What are the hormones secreted b...

Q. What are the hormones secreted by the thyroid gland? What are their functions? The thyroid secretes the triiodothyronine (T3), hormones thyroxine (T4) and calcitonin. T3

Symbiotic interaction - biological stress, Symbiotic interaction - Biologic...

Symbiotic interaction - Biological Stress Presence of symbiotic microorganism can result in differential growth stimulation of those plants which can recognise the beneficial

What are the terms used in sterilization, Q. What are the terms used in ste...

Q. What are the terms used in sterilization? Sterilization: It is defined as freeing the object or substance from all life of any kind. It is defined alternatively as the

Which pga as the first co2 fixation product, PGA as the first CO2 fixation ...

PGA as the first CO2 fixation product was discovered in photosynthesis of: 1. Bryophyte 2. Gymnosperm 3. Angiosperm 4. Alga Alga

Gastrulation in amphibians, Gastrulation in Amphibians Amphibians com...

Gastrulation in Amphibians Amphibians comprise a large and moderately telolecithal egg. Cleavage is holoblastic and unequal generating a spherical blastula along with a reduc

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

The immediate effects of exercise on the heart and the lungs, (a) What are ...

(a) What are the immediate effects of exercise on the functions of (i) the heart, (ii) the lungs, (iii) the liver? (b) How do these changes help to meet the needs of exercise

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd