Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Q. How different are hemoglobin and oxyhemoglobin?
Where is it expected to find a higher concentration of oxyhemoglobin, in peripheral tissues or in the lungs?
Oxygen-bound hemoglobin is called as oxyhemoglobin in the lungs the oxygen concentration is higher and so there is a higher oxyhemoglobin concentration. In the peripheral tissues the situation is the reverse the concentration of oxygen is lower and there is more free hemoglobin.
Explain the difference between numerical chromosome abnormalities and single gene disorders. Describe methods of diagnosing chromosome abnormalities prenatally and after birth. How
Q What is the main source of energy for living beings on earth? The sun, center of our planetary system and star of the Milky Way galaxy (our galaxy), is the source of the ener
Q. What are the hormones secreted by the thyroid gland? What are their functions? The thyroid secretes the triiodothyronine (T3), hormones thyroxine (T4) and calcitonin. T3
pisces kingdom
Symbiotic interaction - Biological Stress Presence of symbiotic microorganism can result in differential growth stimulation of those plants which can recognise the beneficial
Q. What are the terms used in sterilization? Sterilization: It is defined as freeing the object or substance from all life of any kind. It is defined alternatively as the
PGA as the first CO2 fixation product was discovered in photosynthesis of: 1. Bryophyte 2. Gymnosperm 3. Angiosperm 4. Alga Alga
Gastrulation in Amphibians Amphibians comprise a large and moderately telolecithal egg. Cleavage is holoblastic and unequal generating a spherical blastula along with a reduc
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
(a) What are the immediate effects of exercise on the functions of (i) the heart, (ii) the lungs, (iii) the liver? (b) How do these changes help to meet the needs of exercise
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd