Difference between fat-soluble and water-soluble vitamins, Biology

Assignment Help:

Q. What is the difference between fat-soluble and water-soluble vitamins? Why can fat-soluble vitamins cause harm when ingested in excess?

Water-soluble vitamins are those vitamins that are soluble in water. Fat-soluble vitamins are those soluble in oil that is lipids and fat.

Vitamin C and the vitamins of the B complex are types of water-soluble vitamins. Vitamins A, D, E and K are types of fat-soluble vitamins.

Fat-soluble vitamins, since they aren't soluble in water cannot easily be excreted by the body so they tend to accumulate in tissues with toxic effect when they are ingested in amounts over what is necessary.


Related Discussions:- Difference between fat-soluble and water-soluble vitamins

Why should an athletes take proteins, Why should an athletes take Proteins?...

Why should an athletes take Proteins? Proteins are basically taken for their ergogenic properties of enhancing endurance and increasing or maintaining muscle mass to improve st

Define measuring body composition- multiple isotope dilution, Define measur...

Define measuring body composition- Multiple isotope Dilution? Multiple isotope dilution (Total and extracellular body water): It is based on the principle that certain substanc

Determine the phylum annelida to arthropods, What is the morphological char...

What is the morphological characteristic that evolutionarily approximates the beings of the phylum Annelida to arthropods? The metameric feature, i.e., the body segmentation in

Class of coclentrata, ????? # 100 ??????????? #Minimum ?????? ?????

????? # 100 ??????????? #Minimum ?????? ?????

Types of bone, TYPE S OF BONE - On the basis of its texture , a bone ...

TYPE S OF BONE - On the basis of its texture , a bone is of two types - Spongy or cancellous or tubercular bone and Compact or periosteal or dense bone.

Viruses, are viruses cellular organisms

are viruses cellular organisms

Nursing assessment of thalassemia patient, Nursing Assessment  If you ...

Nursing Assessment  If you observe a child of thalassemia major you can identify the following clinical  manifestations:  Anaemia with haemoglobin level of 3 to 8 gm per ce

Define the contraceptive morbidity, Define the Contraceptive Morbidity ...

Define the Contraceptive Morbidity Contraceptive morbidity, which covers any condition that result from efforts (other than abortion) to limit fertility, whether they are tradi

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd