Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Q. What is the difference between fat-soluble and water-soluble vitamins? Why can fat-soluble vitamins cause harm when ingested in excess?
Water-soluble vitamins are those vitamins that are soluble in water. Fat-soluble vitamins are those soluble in oil that is lipids and fat.
Vitamin C and the vitamins of the B complex are types of water-soluble vitamins. Vitamins A, D, E and K are types of fat-soluble vitamins.
Fat-soluble vitamins, since they aren't soluble in water cannot easily be excreted by the body so they tend to accumulate in tissues with toxic effect when they are ingested in amounts over what is necessary.
what is its working
Why should an athletes take Proteins? Proteins are basically taken for their ergogenic properties of enhancing endurance and increasing or maintaining muscle mass to improve st
Define measuring body composition- Multiple isotope Dilution? Multiple isotope dilution (Total and extracellular body water): It is based on the principle that certain substanc
What is the morphological characteristic that evolutionarily approximates the beings of the phylum Annelida to arthropods? The metameric feature, i.e., the body segmentation in
????? # 100 ??????????? #Minimum ?????? ?????
TYPE S OF BONE - On the basis of its texture , a bone is of two types - Spongy or cancellous or tubercular bone and Compact or periosteal or dense bone.
are viruses cellular organisms
Nursing Assessment If you observe a child of thalassemia major you can identify the following clinical manifestations: Anaemia with haemoglobin level of 3 to 8 gm per ce
Define the Contraceptive Morbidity Contraceptive morbidity, which covers any condition that result from efforts (other than abortion) to limit fertility, whether they are tradi
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd