Determine the nutritional needs of humans, Biology

Assignment Help:

Determine the nutritional needs of humans?

In the previous unit, we saw how involvement in sport or vigorous activities can affect the body's nutrient needs. In this unit, we will focus on nutritional needs of humans who are away from the normal conditions of living environment i.e. affected  by calamities or emergencies (natural or manmade) or exposed to environmental  extremes such as hot, cold, rugged terrain environments as high attitudes. All major emergencies often result in food shortage, impair the nutritional status of population and cause excessive mortality in almost all age groups. In such cases, nutritional awareness becomes important for planning the emergency management.

Human beings can function effectively in extreme environments, provided adequate behavioural precautions (proper clothing, shelter, food and water) are taken.  Expeditionary or recreational outdoor activities are generally conducted in hot, cold, rugged terrain environments such as high altitudes. Mountaineering, cross-country skiing, snowshoeing, sledging and backpacking can be physically demanding along with an added element of danger due to environmental wilderness. These areas need to be manned by armed forces personnel if national boundaries run through such locations for security reasons.

In such cases, it has been observed that miscalculation of physical abilities or inadequate preparedness can be life threatening. Nutrition is a prime need for survival, sustaining physical and mental performance. Under this unit, you will read how nutritional requirements vary with the environment and also about the minimum requirements to prevent malnutrition-related diseases and mortality in emergency situations. You will appreciate the role of nutritional sciences in human success on the planet Earth and in space exploration, which is relatively a new frontier with microgravity as main stress factor.

Objective

After studying this unit, you will be able to:

  • describe nutritional needs during calamities and emergencies,
  • understand the nutrient requirements for working under environmental extremes i.e. hot, cold and high altitudes, and
  • Discuss the nutritional needs during space travels.

Related Discussions:- Determine the nutritional needs of humans

What are the physiological systems, What are the physiological systems know...

What are the physiological systems known as integrative systems? Why is this designation justified? The integrative systems are the nervous system and the endocrine system. The

Meiosis, What problem would most likely to occur if a haploid cell attempte...

What problem would most likely to occur if a haploid cell attempted to perform meiosis?

Describe about the therapies of illicit drugs, Describe about the therapies...

Describe about the therapies of illicit drugs do to the brain Despite recent availability of new therapies for addiction, only a small proportion of people who need treatment

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Compound leaf, Compound leaf is the leaf in which the blade forms small le...

Compound leaf is the leaf in which the blade forms small leaflets. Compound leaves which have several small leaflets originating from the central axis are termed as pinnately comp

Define the composition of potato dextrose agar, Define the Composition of P...

Define the Composition of Potato Dextrose Agar? This media is used for cultivation of yeasts, fungi and moulds. Potato (Peeled) - 200.0 gm Dextrose - 20.0 gm Agar - 15

Describe surgical closure of patent arteriosus technique, Describe Surgical...

Describe Surgical Closure of Patent Ductus Arteriosus technique? The patient is positioned in right lateral position and a left posterolateral thoracotomy is done. In infants

Nature of neuropsychological tests, Nature of neuropsychological tests ...

Nature of neuropsychological tests Neuropsychological tests are aids in the neuropsychological examination. The tests calculates specified psychological processes including the

Genetics Problems, Andalusian chickens may be either black, white, or gray....

Andalusian chickens may be either black, white, or gray. The gene for black is not dominant over the gene for white, nor is the gene for white dominant over the gene for black. Whe

Define the interaction of vitamin c with lead and mercury, Define the inter...

Define the interaction of vitamin c with lead and mercury? Vitamin C, lead and mercury: Iron alleviates lead toxicity but ascorbic acid is ineffective. Ascorbic acid alleviat

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd