Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
1. In guinea pigs, black coat color (B) is dominant to white (b), and a rough coat (R) is dominant to smooth (r). What are the expected genotypic and phenotypic results of the following crosses?
BBRR x bbrr
BBrr x bbRR
Bbrr x bbRr
BBRr x BbRr
BbRr x BbRr
1. The genes for ruby eyes (rb), tan body (t) and cut wings (ct) are all found on the X-chromosome of Drosophila melanogaster. All of these are recessive traits. They map in the or
What do you understand by Polyp? The sessile, asexual stage in the cnidarian life cycle. In some species they are independent organisms; in others, they form colonies where som
Habit and habitat
Q. How is HIV transmitted? What is the disease caused by this virus? The HIV (human immunodeficiency virus) is supposed to be transmitted through blood, semen, vaginal secretio
Q. Can you explain Aneurysm of Aorta? CXR findings are an enlargement of the involved portion of the aorta. A focal dilatation may simulate a mass or adenopathy. A more general
Conservation of biodiversity is very important to maintain the ecological balance of ecosystem. Various steps for conservation of biodiversity: 1. Creation of consc
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Compare changes in the carbon cycle to that of the nitrogen cycle on human health. Please make a conceptual graphical model for how changing the carbon cycle is likely to impact hu
Degree of dispersion of protein solution is decreased. It is decreased because of certain reasons:- Association: refers to changes occuring at subunit or molecular leve
What is a terrestrial organism? 'Terra' is the Latin word for earth. Thus, an animal that lives on the surface of the earth is known as terrestrial. This is the similar root wo
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd