Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Determine Functions of Zinc in the Body?
Zinc is an essential component of a large number of enzymes participating in the synthesis and degradation of carbohydrates, lipids, proteins and nucleic acids, as well as, in the metabolism of other micronutrients. Zinc stabilizes the molecular structure of cellular components and membranes and in this way contributes to the maintenance of cell and organ integrity.
Furthermore, zinc has an essential role in polynucleotide transcription and thus, in the process of genetic expression. Zinc also plays a central role in the immune system, affecting a number of aspects of cellular and humoral immunity. Shankar and Prasad have reviewed the role of zinc in immunity extensively. Its involvement ill such fundamental activities probably accounts for the essentiality of zinc for all life forms. These divergent functions of zinc in the body can be grouped into three categories namely, catalytic, structural and regulatory.
Q. What is the difference between temporal summation and spatial summation of muscle fibers? What is tetany? Spatial summation is the recruiting of new muscle fibers to incr
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Define Feeding Options for Premature and LBW Babies? Different workers have tried different method and since all methods are successful, it is dependent on the individual infan
Vesicular stomatitis Vesicular stomatitis (VS) is an infectious viral disease of horses, cattle and pigs caused by Vesiculovirus of the family Rhabdoviridae and characterized by f
Q. What is the cyclosporin? How are fungi related to this substance? Cyclosporin is a drug discovered in the 1970's that revolutionized organ transplantation in Medicine, It is
Motion Sickness The pathogenesis of motion sickness is poorly under- stood. The prescription cholinergic blocker scopolamine in a patch or oral formulation can decrease sympto
Starting at the esophagus, trace the pathway of food through the system. At each organ, indicate anatomical adaptations to the general GI tract tube structure that enhance the spec
The cranial nerves are composed of twelve pairs of nerves which emanate from the nervous tissue of brain. In order to reach their targets they should ultimately exit/enter the cr
What is Active Transport--Secretion This method is now a well accepted process of aqueous formation. The rate of aqueous humour formation depends on the rate of active solute
what is universality of genetic code
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd