Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Define the Nutritional shortcomings among the elderly?
Nutritional shortcomings are common among the elderly; most often due to poor choice of foods i.e. they may be consuming least nutritious choices in each food group. Consumption of refined cereals like white bread and 'naan' etc., instead of whole wheat flour chapatti and fruit juice instead of whole fruit deprives the elderly person of the essential and vital nutrients and fibre. Elderly also tend to eat fewer servings of the recommended foods groups which leads lo inadequacy of not only the total calories but also of several micronutrients. Certain culinary practices like overcooking of vegetables to make then soft, washing after culling ad discarding excess of water in which they were cooked, further leads to leaching of nutrients.
Methods to Overcome Incompatibility It has been possible to facilitate the germination of incompatible pollen by extracting pollen wall proteins from compatible pollen and su
which area of the basal nuclei is responsible for controlling appendicular muscle tone?
These are safe and free of systemic side effects. However, gastrointestinal side effects are common, and compliance is poor. The average LDL decreases by approximately 15 per cent
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Explain Measurement of Cell Mass - Microbial Estimation? You may recall reading earlier that filamentous bacteria and moulds cannot be counted satisfactorily by employing plate
R a b i e s It is also known as lyssa, and hydrophobia in human beings. This fatal disease is characterized by altered behavior, deranged consciousness, laryngeal paralysi
Neuropsychological screening of adults Normally, a neuropsychological examination explores in depth an individual's performance in a wide range of functional domains. There are
respiratory system in amphibains
What is Physiology: Root Pressure explain briiefly? Transport of water, minerals and nutrients within vascular plants is dramatically different from animals such as humans. Whe
Q. What are biogeochemical cycles? The Biogeochemical cycles are representations of the circulation and recycling of matter in nature. The major biogeochemical cycles studie
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd