Define th technique - stage two using a mucoperiosteal flap, Biology

Assignment Help:

Stage two using a mucoperiosteal flap

A Mid crestal incision over the implant site is made and reflection of mucoperisteal flap is done under local anesthesia. After locating the implant, the cover screw is unthreaded and the healing abutment is tightened and the flap sutured with interrupted sutures around the healing abutment.

 


Related Discussions:- Define th technique - stage two using a mucoperiosteal flap

Define effect of minerals on athletes, Define effect of Minerals on athlete...

Define effect of Minerals on athletes? Mineral supplementation, particularly iron in cases of iron deficient athletes is beneficial. Similarly, magnesium and chromium supplemen

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Material basis of primitive life, Material Basis of Primitive Life: In ...

Material Basis of Primitive Life: In  the primitive society, human beings invented tools for catching animals, and for collecting, transporting and even preparing food.  They l

How to prevent or overcome this nutritional deficiency, How to prevent or o...

How to prevent or overcome this nutritional deficiency?  A large number of government schemes and programmes have been launched about which we have already studied in the Publi

What is secretary diarrhoea, Q. What is Secretary diarrhoea? Secretary ...

Q. What is Secretary diarrhoea? Secretary diarrhoea: It is a result of active secretion OF electrolytes and water by the intestinal epithelium caused by bacterial and viral inf

Characteristics of genetically modified foods, Normal 0 false ...

Normal 0 false false false EN-US X-NONE X-NONE MicrosoftInternetExplorer4

What, what are mendal low

what are mendal low

Define amino acid requirements for human, Define Amino acid requirements fo...

Define Amino acid requirements for Human? Data regarding the essential amino acid requirements of infants, children and adults are given in terms of egg protein and cow's milk

Neurons - nervous system, Neurons - Nervous System Although neurons oc...

Neurons - Nervous System Although neurons occur in a great variety of sizes and morphological forms, they have a basic plan of structure representing certain common characteri

What do you mean by maxilla, Q. What do you mean by Maxilla? The maxill...

Q. What do you mean by Maxilla? The maxilla has ample keratinized tissue that covers the entire palate. This tissue is well-attached and more difficult to mobilize. Nevertheles

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd