Define soy protein concentrates, Biology

Assignment Help:

Define Soy Protein Concentrates?

The Association of American Feed Control Officials, Inc. (AAFCO) specifies soy protein concentrates as follows: "Soy Protein Concentrate is prepared from high quality, sound, clean, dehulled soybean seeds by removing most of the oil and water soluble non-protein constituents and must contain not less than 70% protein on a moisture free basis." Edible soybean protein concentrates are relatively new products. Their availability as commercial products dates from 1959. In the last 30 years or so, these versatile products have become important ingredients, well accepted by many food industries. In many applications, they simply replace soy flours. In others, they have specific functions, which cannot be performed by soy flours. Historically, the need for the development of soybean protein concentrates stemmed primarily from two considerations: to increase protein concentration and to improve flavour.

The products containing about 70% protein are prepared from defatted meal by selective extraction of the soluble carbohydrates (sugars). Extraction with aqueous alcohol is the most common process, but other methods of production are also available. The concentrates are essentially bland. Soybean protein concentrates normally cost 2 to 2.5 times more than defatted soy flour. Considering the relative protein contents of these two products, the cost per unit weight of protein is about 80% higher in the concentrate. The starting material for the production of soy protein concentrates is dehulled, defatted soybean meal with high protein solubility (white flakes). The concentration of protein is increased by removing most of the soluble non-protein constituents. These constituents are primarily soluble carbohydrates (mono, di and oligosaccharides), but also some low molecular weight nitrogenous substances and minerals. Since some low molecular weight proteins are also extracted along with the sugars, the amino acid composition of the concentrates may differ slightly from that of the original flour.


Related Discussions:- Define soy protein concentrates

What is the difference among animal and bacterial cells, Concerning the pre...

Concerning the presence of the nucleus what is the difference among animal and bacterial cells? Animal cells (cells of living beings of the kingdom Animalia) have an interior m

Match each with the corresponding item, Match each item in Column A with th...

Match each item in Column A with the corresponding item in Column B regarding infectious diseases Column A Column B a. Pulmonary tuberculosis i. Enteric infectious protozoan diseas

Explain triangular full mucoperiosteal flaps, Explain Triangular Full Mucop...

Explain Triangular Full Mucoperiosteal Flaps - Endodontic Surgery      - Only vertical releasing incision with the Horizontal incision, -Used at the area of important anatom

Heart output, HEAR T OUTPUT The amount of blood pumped by heart per...

HEAR T OUTPUT The amount of blood pumped by heart per minute. Heart beat is 72. Pump out blood is 70 ml. This 72 × 70 = 5040 ml. ( 5 litres) blood is pumped in a minute.

Chest drainage tubes (24-72 hours), Chest Drainage Tubes (24-72 hours) ...

Chest Drainage Tubes (24-72 hours) Continue milking of chest tube hourly.  Monitor the amount, colour and record on the flow chart.  Assess dressing for any soak

Structure of the intestines, Describe the structure of the intestines. How ...

Describe the structure of the intestines. How are they modified to carryout their functions? How does the human intestine compare to the fetal pig?

What is oogenesis , What is Oogenesis ? The female sex cells, or eggs,...

What is Oogenesis ? The female sex cells, or eggs, are formed in the ovaries, the primary sex organs of the female. The precursor of the egg cells, or oogonia, are formed duri

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Endocrine versus neural integration, Endocrine versus Neural Integration ...

Endocrine versus Neural Integration A question that surely comes across your mind is, "what is the need for two types of integrative mechanisms, the neural and the endocrine"

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd