Define historical example of ecosystems science, Biology

Assignment Help:

 

Define Historical example of Ecosystems Science?

Mathematical and statistical tools are central to enhancing our understanding of large-scale systems and contain, for instance, cybernetics, control theory, thermodynamics, information theory, network theory, self-organization theory, emergence and hierarchy theory, and/or power laws (Muller 1992, 1997). A very compelling illustration of the how the application of mathematical theory to important global-scale ecological problems comes from the work of Allen, Brown, Gillooly (2002). Historically, one of the best prominent but least understood patterns in nature is the well known latitudinal gradient from poles to the equator in biodiversity. All main groups of terrestrial, freshwater, and marine taxa display latitudinal gradients in biodiversity though the principles underlying the origin and maintenance of these patterns have been illusive. Allen et al use a theoretical framework to describe gradients in species diversity in terms of energetics. They obtain a model that quantitatively assumptions that species diversity can be predicted from the biochemical kinetics of metabolism. These results established a thermodynamic basis for the regulation of species diversity and the company of ecological communities.

 

 


Related Discussions:- Define historical example of ecosystems science

Successive changes in animal life during hydrosere, Successive Changes in A...

Successive Changes in Animal Life during Hydrosere The successive changes in plant communities in the different seral communities of a hydrosere. The question arises, is ther

Air pollutants - effects on plants, Air pollutants - Effects on plants ...

Air pollutants - Effects on plants Particulate matter such as cement, coal, petro coke, dust, and fly-ash screen the light and thus change its quantity and quality. Dust plug

Mention the role o ribosome in peptide, Mention the role o ribosome's in pe...

Mention the role o ribosome's in peptide -bond formation .How does ATP facilitate it? a) Of springs derived by asexual reproduction are known as clones. Justify giving two R

Essay, “Define nosocomial infections. Discuss the factors that might influe...

“Define nosocomial infections. Discuss the factors that might influence whether a patient may acquire nosocomial infection. How might these risks be reduced?”

Phylum , General characteristics of phylum

General characteristics of phylum

Important herbaria, Q. Important Herbaria? The herbarium is a place whe...

Q. Important Herbaria? The herbarium is a place where dried and mounted specimens are stored according to any recognised system of classification. Special attention is paid tow

Extraradicular infections, Extraradicular Infections Whatever the cause...

Extraradicular Infections Whatever the cause of post endodontic disease we should do proper diagnosis to determine what is the cause; is it intra or extraradicular infection ,

Origin of endoplasmic reticulum, ORIGIN OF E.R. (1 )      Originates...

ORIGIN OF E.R. (1 )      Originates from plasma membrane. (2 )      According to Haguenau, E.R.originates from Nebenkern (Germ center). Nebenkern is a group of conce

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

To study if bacteria grow better where it is dark or light, To study if bac...

To study if bacteria grow better where it is dark or light Inoculate two sterile dishes as before. Label one 'dark' and the other 'light'. Place the 1st dish in a darkwarm plac

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd