Define exclusion chromatography - basic separation technique, Biology

Assignment Help:

Define Exclusion chromatography - basic separation technique?

It is a chromatographic process, in which separation of the sample components takes place according to the molecular size e g. gel filtration and molecular sieving.

 


Related Discussions:- Define exclusion chromatography - basic separation technique

Define pacinian corpuscules, Q. Define Pacinian corpuscules? Pacinian ...

Q. Define Pacinian corpuscules? Pacinian corpuscules are an example of sensory receptors scattered deep in the subcutaneous tissue underlying skin or in viscera.  These mech

Trophic structure-structure of community, Trophic structure Organisms i...

Trophic structure Organisms in a community are closely interrelated with each other through feeding relationships. Another aspect which is quite obvious in a community is th

Release of microspores, Release of Microspores Up to the tetrad stage...

Release of Microspores Up to the tetrad stage, there is no cellulosic wall around the microspores. As you will come to know in the next unit, a unique feature of the pollen i

How is excretion done in fishes, How is excretion done in fishes? Fish...

How is excretion done in fishes? Fishes have a pair of kidneys that filtrate the blood. Bony fishes excrete nitrogen as ammonia, NH 3 , (they are ammoniotelic) and cartilagino

Define evolution of virulence, Define Evolution of virulence? Diseases ...

Define Evolution of virulence? Diseases like cholera emerge as sudden outbreaks, showing marked variation via space and time both in their incidence--the number of individuals

What do you mean by connective tissue proper, Q. What is connective tissue ...

Q. What is connective tissue proper? The name connective tissue proper is used to designate the connective tissue that fills interstitial spaces as opposed to the specialized c

Reproduction, Normal 0 false false false EN-IN X-NONE...

Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4

Digestion, Adsk question #Minimum 100 words accepted#saliva enzyme

Adsk question #Minimum 100 words accepted#saliva enzyme

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain mental changes - clinical signs of kwashiorkor, Explain Mental chan...

Explain Mental changes - clinical signs of kwashiorkor? You would find a kwashiorkor child to be unusually apathetic with absolutely no interest in the surroundings. The child

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd