Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Define Exclusion chromatography - basic separation technique?
It is a chromatographic process, in which separation of the sample components takes place according to the molecular size e g. gel filtration and molecular sieving.
Q. Define Pacinian corpuscules? Pacinian corpuscules are an example of sensory receptors scattered deep in the subcutaneous tissue underlying skin or in viscera. These mech
Trophic structure Organisms in a community are closely interrelated with each other through feeding relationships. Another aspect which is quite obvious in a community is th
Release of Microspores Up to the tetrad stage, there is no cellulosic wall around the microspores. As you will come to know in the next unit, a unique feature of the pollen i
How is excretion done in fishes? Fishes have a pair of kidneys that filtrate the blood. Bony fishes excrete nitrogen as ammonia, NH 3 , (they are ammoniotelic) and cartilagino
Define Evolution of virulence? Diseases like cholera emerge as sudden outbreaks, showing marked variation via space and time both in their incidence--the number of individuals
Q. What is connective tissue proper? The name connective tissue proper is used to designate the connective tissue that fills interstitial spaces as opposed to the specialized c
Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4
Adsk question #Minimum 100 words accepted#saliva enzyme
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Explain Mental changes - clinical signs of kwashiorkor? You would find a kwashiorkor child to be unusually apathetic with absolutely no interest in the surroundings. The child
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd