Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Q. How does the circulatory system participate in the functioning of the endocrine system?
The circulatory system is basic for the functioning of the endocrine system and the blood collects the hormones made by the endocrine glands and through the circulation these hormones reach their targets without the circulatory system the 'action at distance' characteristic of the endocrine system would not be possible.
Diagnosis Lumbar puncture is done which shows cloudy CSF with increased pressure, the white cell count predominantly contains neutrophils. CSF proteins are increased but sug
Q. What is the uncontrolled mitotic procedure that occurs as disease in pluricellular beings called? Uncontrolled mitotic cell division is known as neoplasia. Neoplasia the for
Why Dairy or milk product are important for human body? This first food of mammals is rich in body-building proteins and bone-forming calcium, besides being the only source of
A newborn baby with a patent foramen ovale or a ventricular septal defect might be cyanotic (blue). Will a two-year-old with these defects also be cyanotic? Explain your answer.
GLANDS - 1 . LACRYMAL GLANDS - Tear glands numbers are 3. Its secretion is aquous & salty, keeps eye ball wet, give nourishment to cornea. Lysozyme also present
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
briefly deccribe the eggs snd follicles
During the life cycle of most animals, some diploid cells undergo meiosis and haploid form in a process called gametogenesis. Spermatogenesis: In the testes of the male, the
Patient is a 7-year-old girl who was brought to her physician by her mother with complaints of general fatigue, anorexia, and unexplained bruises and "rash" for the past 2 weeks. C
What is the exchange list? IL is a grouping of foods in which specified amounts of all the foods provide approximately equal amount of (the same amount) carbohydrate, protein a
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd