Define about the resistant starch, Biology

Assignment Help:

Define about the Resistant Starch?

Until 1980's starch was thought to be completely hydrolyzed and absorbed from the small intestine of man, independent of its source, type and preparation. However, about two decades ago, it became apparent that appreciable amounts of starch are not digested and enter the colon. The term 'Resistant Starch' (RS) was coined for this fraction. Recently, RS has been an active area of research because of its potential health benefits especially its effect on the large bowel functions. Therefore, in this section we will talk about what RS is, how RS content of food is' influenced and its beneficial effects.


Related Discussions:- Define about the resistant starch

Viruses, what is the basic structure of a virus?

what is the basic structure of a virus?

Define larval stages of fasciola hepatica fasciola hapatica, Define the Lar...

Define the Larval stages of fasciola hepatica? Fasciola hapatica reproduces both sexual and asexually. Cross-fertilization is of common occurrence. Copulation takes place in t

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain oligosaccharides, Oligosaccharides Compounds containing 2 to 6 ...

Oligosaccharides Compounds containing 2 to 6 monosaccharides units joined by a glycosidic  linkage.

Water logging-water stress, Water Logging Over saturation of soil with ...

Water Logging Over saturation of soil with water is called water logging. If for any reason, the water-table rises close to the ground surface it is bad for plants and soil fer

Direction of flow, Direction of flow--either towards or away from the trans...

Direction of flow--either towards or away from the transducer (positive or negative Doppler shifts). Timing-instantaneous velocity and direction of flow throughout the various

Which type neurons work for spinal arch reflex, Q. Which are the kinds of n...

Q. Which are the kinds of neurons that participate in the spinal arch reflex? Where are their cell bodies situated? In the arch reflex first a sensory neuron located in the gan

Liver, how the gall bladder develops in a trnsplanted liver tissue ?

how the gall bladder develops in a trnsplanted liver tissue ?

Physical and chemical factors that affect the pasteurization, Define the Ph...

Define the Physical and Chemical Factors That Affect the Pasteurization? There are a few other physical and chemical factors that affect the pasteurization method. These involv

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd