Control of air pollution, Biology

Assignment Help:

Air pollution can be controlled by two fundamental ways.

Preventive technique:

Important measure to control air pollution

  • Suitable fuel having low sulphur content should be used.
  • Selection of suitable manufacturing site and zoning for industrial set up to disperse pollution sources eg. Setting of industries at a distance of residential areas.
  • Modification of industrial processes and equipments to reduce emission.
  • Building of higher stake facility for discharges of pollutants into air.

 

Effluents control:

  • Substitution of raw-materials causing more pollution with that of less pollution causing materials.
  • Use of non-conventional fuels like; Gobar gas ,Biogas, CNG and LPG must be prepared and encouraged.
  • Use of equipments/devices for removal of pollutants from exhaust gages eg. Scrubbers, dry and wet collectors, filters, electrostatic precipitators etc.
  • Growing and developing green belt and forests.

 

 


Related Discussions:- Control of air pollution

Algae, what are the characteristics of algae?

what are the characteristics of algae?

Symptoms of oesophagitis, Q. Symptoms of oesophagitis? The symptoms of ...

Q. Symptoms of oesophagitis? The symptoms of oesophagitis include heartburn or pyrosis, iron-deficiency anaemia due to chronic tissue bleeding, aspiration, which may cause coug

Integumentary, What modern technology used for the integumentary system?

What modern technology used for the integumentary system?

What is the gel electrophoresis, Which of the following is a false stateme...

Which of the following is a false statement regarding gel electrophoresis? A. An electric current is used in order move DNA fragments by a semi-porous gel. B. Fragments of n

Skeletal tissue, what is the classification of skeletal tissue?

what is the classification of skeletal tissue?

Name a few foods which are best blanched, Name a few foods which are best b...

Name a few foods which are best blanched? Yes, green beans, carrots, okra, turnip and cabbage should always be blanched. On the other hand, blanching is not needed for onions,

Deterimne when lysosomic enzymes play a fundamental role, What are some bio...

What are some biological examples in which lysosomic enzymes play a fundamental role? The remodelation of the osseous tissue, the function of acrosomes in sperm cells and the e

Interactions between minerals, Interactions between minerals Copper de...

Interactions between minerals Copper deficiency has been identified as a serious problem for grazing ruminants. A deficiency may be due to low concentrations of Cu in forage a

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain the fluoride toxicity, Explain the Fluoride Toxicity? Fluoride ...

Explain the Fluoride Toxicity? Fluoride is a cumulative toxin. Ingestion of fluoride 1.0-1.5 mg/L for several years may produce dental fluorosis, i.e. browning and pitting of t

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd