Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Q. Complications in dyslipidemia?
The complications include:
• Pancreatitis
• Progressive atherosclerosis or asymptomatic coronary.
Excess of triglycerides (hypertriglyceridemia) and cholesterol (hypercholesterolemia) are the usual problems for increase in very low-density lipoprotein cholestrol (VLDL c), low-density lipoprotein cholesterol (LDL c) levels. The following are possible causes of elevated triglycerides and cholesterol and reduced HDL c levels
Hypoglycaemia When Driving Hypoglycemia is particularly dangerous if it happens to someone who is driving. People with hypoglycemia may have trouble concentrating or se
How to improve the Quality of Protein in the Diet? Since the net protein utilization (NPU) values of milk or egg proteins are higher than those of proteins of average diets con
Define the term - cerebral arteriosclerosis An embolism can be a blood clot, a bubble of air, a deposit of oil or fat, or a small mass of cells detached from a tumor. Reduction
Explain the Penicillium - Fungi? Classification Kingdom - Mycetae Division - Amastigomycota Class - Ascomycetes Subclass - Plectomycetidae Order - Eurotiales
Why Deficiency of Folate take place? If there is inadequate dietary folate, the activity of both the DNA and the methylation cycles, described above, will be reduced. A decrea
A Complex of elongation factor EF-G (also known as translocase) and GTP example for EF-G/GTP binds to the ribosome. There are three concerted movements now happen coll
Q. What do you mean by ST-Segment in Exercise Induced PVC? Ans. Over the years it has been believed that repolarization in ventricular ectopic beats had no diagnostic si
Why is the dietary obtainment of iodine so important for thyroid functioning? The obtainment of iodine from the diet is significant for the thyroid because this chemical elemen
Where in the leaves is photosynthetic tissue often located? The major photosynthetic tissue is the photosynthetic parenchyma (also known as chlorenchyma, do not confuse with co
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd