Cold chain system, Biology

Assignment Help:

Cold Chain System

Vaccines are sensitive to heat. On exposure to heat their potency is lost. Once a vaccine has lost its potency it cannot be regained, so it is important to maintain cold chain. we shall briefly outline the Cold chain system here.

One of the important components of EPI and UIP is the maintenance of cold chain. The cold chain consists of a series of transportation links during which adequate refrigeration is required to maintain potency of vaccine. All vaccines retain their potency at temperature between + 2 to + 8 degree Celsius. The temperature of refrigerator should be recorded on temperature chart everday. Dial thermometer is used to check temperature of the vaccine. The vaccines should not be frozen or exposed to direct sun light.


Related Discussions:- Cold chain system

What are the different phenotype, What is the genetic condition in which th...

What is the genetic condition in which the heterozygous individual has different phenotype from the homozygous individual? This condition is called lack of dominance and it can

Define historical example for dynamical network, Define Historical example ...

Define Historical example for Dynamical Network? John Tyson constructed a nonlinear differential equation model representing the majority of the network of biochemical pathways

Jaundice (icterus), Jaundice (Icterus) Jaundice is classified as pre-he...

Jaundice (Icterus) Jaundice is classified as pre-hepatic (hemolytic), hepatic and post-hepatic (obstructive) depending on origin of the problem, and is characterized by yellowi

How to load glycogen, How to load glycogen? Over the past fifty years, ...

How to load glycogen? Over the past fifty years, the biggest breakthrough was the discovery of how to load glycogen and sophistication in the methods of glycogen loading. Nitro

Define application of nutrition knowledge in geld of sports, Define Applica...

Define Application of Nutrition Knowledge in Geld of Sports? By the time you are ready to do this unit, you have been exposed to a good deal of the basic knowledge of nutrition

What is diabetes mellitus, Question 1 What is diabetes mellitus? Discuss b...

Question 1 What is diabetes mellitus? Discuss briefly its pathogenesis. Explain how would you diagnose this disorder Question 2 Discuss the following Glucose tolerance

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Appendical skeleton, it consists of the girdles and the skeleton of the lim...

it consists of the girdles and the skeleton of the limbs

Define reagents for seliwanoff test, Define Reagents for seliwanoff's tes...

Define Reagents for seliwanoff's test? - Sugar solutions of glucose, fructose, galactose, lactose, maltose, sucrose and starch - Resorcinol in dilute hydrochloric acid (1:

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd