Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
ENTROP Y - Transfer of energy takes place from high energy level to low energy level. Rudol f clausius gave this term. During it there is collision of particles, r
EFFECT ON BODY - 1 . CANCER - Benzpyrene present in tobacco is carcinogenic , responsible for lung cancer. Tobacoo chewing also produce oral cancer. Smoking m
What are presbyopia and astigmatism? Presbyopia is the visual impairment in which there is loss of the cililary muscle strength therefore reducing the capability of the crystal
Q. What are the major characteristics of the bryophytes? Bryophytes are nonvascular plants that is they do not have conductive tissues and they perform transport of nutrients a
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
What is the relation between secretion of parathormone and the calcium blood level? The parathormone enhances the calcium blood level as it stimulates the resorption (remodelat
what is the skeleton in the different classes of coelentrata known
What is Burden of Rheumatic Heart Diseases? Although in the twenty-first century RHD has been eradicated in western countries, in India and other developing countries it contin
Placement of implant with improper axial angulation Surgical placement of the implant improperly can lead to a prosthetic rehabilitation that compromises esthetics and the dist
Q. Show the Anatomical Evidence? Anatomy is the study of the structure, organisation and development of cells and tissues of plants and animals. For over a century taxonomists
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd