cockroach heart, Biology

Assignment Help:
How last chamber of heart in cockroach receives blood without having ostia?

Related Discussions:- cockroach heart

Entropy, ENTROP Y - Transfer of energy takes place from high energy...

ENTROP Y - Transfer of energy takes place from high energy level to low energy level. Rudol f clausius gave this term. During it there is collision of particles, r

Effect of smoking on body, EFFECT ON BODY - 1 .       CANCER - B...

EFFECT ON BODY - 1 .       CANCER - Benzpyrene present in tobacco is carcinogenic , responsible for lung cancer. Tobacoo chewing also produce oral cancer. Smoking m

What are presbyopia and astigmatism, What are presbyopia and astigmatism? ...

What are presbyopia and astigmatism? Presbyopia is the visual impairment in which there is loss of the cililary muscle strength therefore reducing the capability of the crystal

What are the major characteristics of the bryophytes, Q. What are the major...

Q. What are the major characteristics of the bryophytes? Bryophytes are nonvascular plants that is they do not have conductive tissues and they perform transport of nutrients a

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain secretion of parathormone and calcium blood level, What is the rela...

What is the relation between secretion of parathormone and the calcium blood level? The parathormone enhances the calcium blood level as it stimulates the resorption (remodelat

., what is the skeleton in the different classes of coelentrata known

what is the skeleton in the different classes of coelentrata known

What is burden of rheumatic heart diseases, What is Burden of Rheumatic Hea...

What is Burden of Rheumatic Heart Diseases? Although in the twenty-first century RHD has been eradicated in western countries, in India and other developing countries it contin

Placement of implant with improper axial angulation, Placement of implant w...

Placement of implant with improper axial angulation Surgical placement of the implant improperly can lead to a prosthetic rehabilitation that compromises esthetics and the dist

Show the anatomical evidence, Q. Show the Anatomical Evidence? Anatomy ...

Q. Show the Anatomical Evidence? Anatomy is the study of the structure, organisation and development of cells and tissues of plants and animals. For over a century taxonomists

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd