Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Cell culture products:
Animal cell cultures are used to generate virus vaccines, as well as different kind of useful biochemical which are mainly high molecular weight proteins like cellular, hormones, enzymes biochemical like, immunobiological and interferons compounds including monoclonal antibodies. Animal cells are also fine host for the expression of recombinant DNA molecules and a many commercial products have been/ are being developed. Firstly virus vaccines were dominant commercial products from cell cultures, but now monoclonal antibody production is the main product from cell cultures in the near future. Organs and transplantable tissues are another very precious product from cell cultures. Artificial skins are creating transplantable cartilage and other tissues.
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Amoebae- Parasitic Protozoan The amoebae of the genus Entamoeba vary in their biology. Entamoeba histolytica or the dysentery amoeba occurs as a parasite in the large intestin
Define the Bacillus cereus Bacillus cereus is not a common cause of food poisoning. It is a Gram positive, aerobic, spore forming rod shaped bacteria normally present in soil,
What in Genetics is hybridization? Hybridization in Genetics is the crossing of individuals from "pure" and dissimilar lineages in relation to a given trait, i.e., the crossing
Explain the Primary Treatment for Managing Food Allergies? The primary treatment for managing food allergies is eliminating the offending food or foods. In fact, non-pharmacolo
Explain Non-Glycerides in Edible Oils? You may be aware of the fact that the glyceride fraction (an ester of glycerol and fatty acids that occurs naturally as fats and fatty oi
Question 1: Briefly explain the applications of various technologies in biotechnology. Definition of biotechnology Brief on different applications of various technolo
subject for botany assignment
Explain solid salt and saturated aqueous solution? In this example, the equilibrium system consists of crystalline PbCl 2 and an aqueous phase containing the species H 2 O, P
Explain the Appearance of the Pupil The pupil should appear round and regular. The normal diameter is 2-4 mm. On stimulation by light, the pupil constricts, so as to redu
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd