Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Botulism
It is a toxicity in chickens, turkeys, ducks and other aquatic birds caused by a bacterial toxin produced by anaerobic bacteria Clostridium botulinum mainly types A and C. The toxin produced in decaying carcass and plant waste is consumed by the birds or the birds infected with Cl. botulinum may produce it in the cecum. Morbidity is usually low but mortality is high.
Symptoms and lesions: The birds show nervous signs, progressive flaccid paralysis of legs and wings before death or in peracute cases, sudden death. When neck muscles are affected, the head hangs limp, thus causing a condition referred to as limberneck. Affected birds may have a peculiar trembling, loose feathers that are pulled out easily and dull partly closed eyes. In most of the cases, there are no PM lesions. In others, severe enteritis may be seen.
Diagnosis: Clinical history and signs may be adequate to diagnose the condition. For confirmation, biological test is done in mice. The supernatant of the centrifuged intestinal contents (particularly from cecae) of the dead bird, membrane filtered and inoculated into mice will kill them quickly.
Prevention and control: Biosecurity is the best way of prevention. Preventing access to toxin, suspect food and stagnant ponds, especially in hot weather is an adequate method.
Do all genetic diseases result from alteration in the number of chromosomes of the cells? Besides aneuploidies there are other genetic diseases, other chromosomal abnormalities
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Q. Define Myocardial infraction and stress testing? Prediction of disease is one of the primary functions of stress testing. We would like to be able to predict in each patient
FUNCTION S OF KIDNEY - 1. Excretion of nitrogenous wastes. 2. Maintenance of water balance or osmoregulation. 3. Acid base balance or regulation of pH.
Why is pattern baldness more common in men than in women? Pattern baldness is handled by the allele B. Testosterone interacts with the heterozygous genotype (BB′) to make baldn
Explain the Lamarck's Theory in evolution? Prior to Darwin, most people believed in and held to the creationist viewpoint that species were created in their current forms, whic
Urea is known to denature proteins Based on the structure of urea, how do you think this occurs?
Dormancy - Plant Growth Substances Dormancy can be defined as a state of suspended growth and metabolism. When most plants are exposed to seasonal periods of very inclement we
What is the mechanism of lipolysis?
pioneers of developmental biology and their contribution
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd