Attributes of population, Biology

Assignment Help:

Attributes of Population

The attributes of a population are of two basic types : i) Numerical attributes such as density, mortality (birth rate), mortality (death rate), dispersal and ii) structural attributes like age distribution, dispersion and growth form. Some of the basic attributes of population are briefly described below.

a) Numerical attribute:

Density: number of individuals per unit area.

Natality (Birth rate): the rate at which new individuals are added to a population through reproduction.

Mortality (Death rate): the rate at which individuals are lost from a population by death. ,

Dispersal: the rate at which individuals of a population emigrate or migrate from an area.

b) Structural attributes:

Population growth form: refers to the pattern of population growth. There are two basic patterns of population growth represented by 'T' and "S" shaped growth curves, see Figure for explanation.

841_atributes of population.jpg



Dispersion:
the pattern of distribution of individuals in space, Age distribution: the proportion of individuals of different age groups in a population.

Now you know some of the more important attributes of a population. It is reasonable to ask: How populations are studied? Do all attributes have equal importance, or are some more important than others? In analysing population, the main attributes studied is the density of the population which depends on four parameters: i) natality, ii) mortality, ii) immigration and, iv) emigration.

 


Related Discussions:- Attributes of population

What is atom, What is atom? Atoms are the smallest component of matter ...

What is atom? Atoms are the smallest component of matter that determine its unique chemical and physical properties. They are composed of negatively charged electrons, positive

The kidney, diseases of the kidney and their remedies

diseases of the kidney and their remedies

Determine dominant individual fromhomozygous or heterozygous, Why can cross...

Why can crossing of an individual that manifests dominant phenotype with another that manifests recessive phenotype (for the same trait) determine whether the dominant individual i

Explain precautions for preparation of bacterial smear, Explain Precautions...

Explain Precautions for Preparation of Bacterial Smear? 1. Plates used should be prepared 24 hours before use to avoid spreading of colonies due to moisture in plates. 2. Sw

Conjugation – protozoan, Conjugation – Protozoan Conjugation is charac...

Conjugation – Protozoan Conjugation is characteristic of ciliates. The details vary from species to species. The general features can be observed in Paramecium sps. which has

Where do the photochemical stages of photosynthesis occur, Where do the pho...

Where do the photochemical and the chemical stages of photosynthesis occur? The photochemical stage of the photosynthesis process happens mainly on the thylakoids (the green pa

The hydrogen ion concentration of stomach, What is the hydrogen ion concent...

What is the hydrogen ion concentration of stomach acid pH=1.6?

How to identify the monomer or molecular components, Please help with the f...

Please help with the following: For each of the four macromolecules carbs, lipids, proteins and nucleic acids, please identify the monomer or molecular components and name the b

How you show that yeast acts on sugar, Normal 0 false false ...

Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd