Assessment - steps in nursing process, Biology

Assignment Help:

Assessment

This includes the data collection (nursing history and physical assessment), comparison of data with the normal, and analysis of the data gathered. Systematic and thorough data collection is the first goal of the nurse when initiating the nursing process. It should include the client's biophysical, psychosocial status and for the older child, spiritual status. Now let us see what actually is assessment.

Nursing Assessment

You will agree with us that nurses should have ability to observe intelligently and systematically. It is a fundamental requisite in nursing assessment and is also essential in all subsequent steps of the nursing process.

  1.  Assessment is a two step process that enables the nurse to identify the client's needs and problems. 
  2.  These two steps are as follows: 

Step I: Data gathering
Step 2: Problem identification.


Related Discussions:- Assessment - steps in nursing process

Explain dietary management, Dietary Management The golden  rule  in  th...

Dietary Management The golden  rule  in  the dietary  management  of  ally  fever  is  "feed  the fever". Considering that  enteric (typhoid) fever  is accompanied by anorexia,

Difference between recessive allele and dominant allele?, What is the diffe...

What is the difference between recessive allele and dominant allele? The Dominant allele is the allele that determines phenotypical features that manifest in heterozygous or ho

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Egg drop syndrome-76 (eds-76), E g g drop syndrome-76 (EDS-76) An out...

E g g drop syndrome-76 (EDS-76) An outbreak of sudden drop in egg production or a failure to achieve a normal peak in production despite optimum managemental and nutrition st

Endomitosis, #questwhy and where endomitosis happens?ion..

#questwhy and where endomitosis happens?ion..

Is expression of cloned gene always a success, Question 1 Is expression of...

Question 1 Is expression of cloned gene always a success? How does the method of molecular photo copying work? Question 2 Explain the control of gene expression with the exam

Nuclear run-on, Nuclear run-on is a technique used to estimate the relativ...

Nuclear run-on is a technique used to estimate the relative rate of the transcription of a given gene, as opposed to steady-state level of the mRNA transcript (which is influenced

Energy flow - ecosystem, Energy Flow - Ecosystem Our world is a solar-...

Energy Flow - Ecosystem Our world is a solar-powered system, and green plants are the entry gates of energy into ecosystem. The total incoming solar energy, only a very small

Define evolution of food processing, Define Evolution of food processing? ...

Define Evolution of food processing? 8000 - 7000 BC. Mankind first began farming, growing crops and raising animals for food instead of hunting and gathering for food.

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd