Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Annuloplasty with a Ring : The lings commonly used are Carpentier- Edwards and Cosgrove's flexible half ring. The rings are C shaped and have incomplete circles to accommodate the conduction pathway. The size of [he ring is selected by the measurement of annular attachment of septal leaflet, as this portion does not get dilated usually. The properly selected ring is fixed to the annulus using 30 polyester sutures,
Leaving the area where the bundle is lo cross the tricuspid annulus.
1. Briefly explain the dynamics in enzyme reaction mechanism with potential energy surface diagram. 2. How to find the rate constant of any enzymetic reaction? 3. Derivation
What is the basic structure of the HIV virus? What is the function of the glycoproteins of its envelope? HIV is an RNA virus. In its core there are two strands of RNA and reve
How last chamber of heart in cockroach receives blood without having ostia?
What is Physical Accommodation Physical Accommodation is the actual physical deformation in the lens power. It is measured in diopters, e.g., if the focussing power of the eye
Q. Illustrate Mitral Valve Orifice Area? The normal mitral valve orifice in an adult is 4-5cm 2 when the valve is completely open in diastole. When the mitral valve orifice ar
Polysaccharide - polymer composed of monosaccharide monomers Starch - Energy storage in plants à straight (amylose) and branched (amylopectin) chains of α-glucose Glycogen
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Q. Show the parameters which are of interest in CHD? Total Cholesterol: Serum totnl cholesterol equals the sum of HDL-cholesterol (HDL-c), VLDL-cholesterol (VLDL-c) and LDL-cho
Problem 1: "Structural Genomics aims at determination of the 3D structure of all proteins". Describe with techniques Show genomic techniques for determination of 3D struc
Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +1-415-670-9521
Phone: +1-415-670-9521
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd