Anabolism and catabolism, Biology

Assignment Help:

Anabolism and Catabolism

Cellular metabolism  has two aspects

1.      Anabolism  : This aspect includes metabolic  process  by which  complex  cellular  compounds  are continuously  synthesized from, simpler   compounds  for growth repair, secretion  storage and  reproduction. Thus it is the constructive  phase  of metabolism .It chiefly   occurs  in the cytosol.

2.      Catabolism : This  aspect includes metabolic  processes  by which larger molecules are continuously broken down to simpler  molecules, releasing energy required  for all cellular functions . Thus it is the degradative   phase  of metabolism  its chief  site are  the mitochondria.


Related Discussions:- Anabolism and catabolism

Explain the surgical management for obesity, Explain the Surgical Managemen...

Explain the Surgical Management for Obesity? Surgical procedures are generally restricted for the morbidly obese persons. If an individual has a BMI of 40 or higher, or a BMI o

Names and uses of the various laboratory tools, What are the names and uses...

What are the names and uses of the various laboratory tools? Tools are beakers, microscopes, tweezers, hot plates, lasers, test tubes, voltmeters, Erlenmeyer flasks, thermomete

What happens to pepsin when it passes into the duodenum, Q. Since pepsin is...

Q. Since pepsin is a gastric enzyme does it have a basic or an acid optimum pH? What happens to pepsin when it passes into the duodenum? Pepsin acts contained by the stomach so

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

What are the maximum crop yields, What are the Maximum Crop Yields   Mi...

What are the Maximum Crop Yields   Mitscherlich conducted a large number of experiments with different plants, making use of pots 20 cm in diameter and 20 cm in depth. By addin

What is the call frequency, During residency: This alters from program to p...

During residency: This alters from program to program depending on the number of sites covered and number of residents. At McMaster, we do call roughly 1 in 7 or 8 (averages out to

Explain the communication process, Q. Explain the communication process? ...

Q. Explain the communication process? Communication is a process by which information is exchanged between individuals through a common system of symbols, signs, or behavior. C

Explain about the toxicity - fat soluble vitamin, Explain about the Toxicit...

Explain about the Toxicity - fat soluble Vitamin? Because vitamin A is fat-soluble and can be stored, primarily in the liver, routine  consumption of large amounts of vitamin A

Which structures of the body have more bones, Q. Which structures of the bo...

Q. Which structures of the body have more bones for their size than any other part of the body? Hand and wrist have more bones in them for their size than any other part of bod

Week 5 Review Sheet I, How does true motility differ from brownian movement...

How does true motility differ from brownian movement? What morphological structre is responsible for bacteria motility? Why is the wet preparation discarded in disinfectant s

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd