Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Anabolism and Catabolism
Cellular metabolism has two aspects
1. Anabolism : This aspect includes metabolic process by which complex cellular compounds are continuously synthesized from, simpler compounds for growth repair, secretion storage and reproduction. Thus it is the constructive phase of metabolism .It chiefly occurs in the cytosol.
2. Catabolism : This aspect includes metabolic processes by which larger molecules are continuously broken down to simpler molecules, releasing energy required for all cellular functions . Thus it is the degradative phase of metabolism its chief site are the mitochondria.
Explain the Surgical Management for Obesity? Surgical procedures are generally restricted for the morbidly obese persons. If an individual has a BMI of 40 or higher, or a BMI o
What are the names and uses of the various laboratory tools? Tools are beakers, microscopes, tweezers, hot plates, lasers, test tubes, voltmeters, Erlenmeyer flasks, thermomete
Q. Since pepsin is a gastric enzyme does it have a basic or an acid optimum pH? What happens to pepsin when it passes into the duodenum? Pepsin acts contained by the stomach so
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
What are the Maximum Crop Yields Mitscherlich conducted a large number of experiments with different plants, making use of pots 20 cm in diameter and 20 cm in depth. By addin
During residency: This alters from program to program depending on the number of sites covered and number of residents. At McMaster, we do call roughly 1 in 7 or 8 (averages out to
Q. Explain the communication process? Communication is a process by which information is exchanged between individuals through a common system of symbols, signs, or behavior. C
Explain about the Toxicity - fat soluble Vitamin? Because vitamin A is fat-soluble and can be stored, primarily in the liver, routine consumption of large amounts of vitamin A
Q. Which structures of the body have more bones for their size than any other part of the body? Hand and wrist have more bones in them for their size than any other part of bod
How does true motility differ from brownian movement? What morphological structre is responsible for bacteria motility? Why is the wet preparation discarded in disinfectant s
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd