Phylum Arthropoda, Biology

Assignment Help:
What is an example of animal coming from the phylum arthropoda?


Related Discussions:- Phylum Arthropoda

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Define the blood coagulation - function of vitamin k, Define the Blood coag...

Define the Blood coagulation - Function of Vitamin K? The primary function of vitamin K in the body is in the maintenance of normal blood coagulation. The vitamin K-dependent c

What happens at the molecular level, An enzyme isolated from a mutant bacte...

An enzyme isolated from a mutant bacterium grown at 20 degrees celsius works in a test tube at 20 degrees celsius but not at 37 degrees celsius( 37 degrees celsius is the temperatu

Rare species - wildlife, Rare Species - Wildlife These are those speci...

Rare Species - Wildlife These are those species whose numbers are few or they live in such small areas or in such unusual environments (endemics), that they could quickly disa

Why are most ammoniotelic beings aquatic animals, Q. Why are most ammoniote...

Q. Why are most ammoniotelic beings aquatic animals? Aquatic animals like crustaceans, amphibian larvae and bony fishes generally are ammoniotelic since ammonia diffuses more e

Gastric mucosa protected from the acid ph of the stomach, Q. How is the gas...

Q. How is the gastric mucosa protected from the acid pH of the stomach? The gastric epithelium is mucus secretory that is it produces mucus, the mucus covers the stomach wall p

Which is utilized by other reactions, The breakdown of ATP releases energy,...

The breakdown of ATP releases energy, which is utilized by other reactions that require energy. Identify other examples where inventions have utilized a similar principle, where en

Differentiate individual atoms true or false, What is the first step normal...

What is the first step normally taken when you look through the oculars? The nuclei of the cheek cells have been stained using a special dye so that they appear purple. What is the

What is vascular cambium? what are their functions?, What is vascular cambi...

What is vascular cambium? What are their functions? The Vascular cambium is the secondary meristematic tissue that in roots and in the stem forms the vascular tissues phloem an

Medical surgical nursing, Medical Surgical Nursing: Medical Surgical N...

Medical Surgical Nursing: Medical Surgical Nursing refers to the  nursing care of adults who have  an actual or potential disorder of physiological functi~n.  The practice of

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd