Write down a perl program that given a dna string prints

Assignment Help Computer Engineering

Reference no: EM13463449

Write a Perl program that given a DNA string, prints out the 20 characters upstream of the start codon ATG. That is, given:

$dna = "CCCCATAGAGATAGAGATAGAGAACCCCGCGCGCTCGCATGGGG";

print out:

The 20 bases upstream of ATG are AGAGAACCCCGCGCGCTCGC

Reference no: EM13463449

Questions Cloud

Write a perl subroutine that reads in a file containing two : write a perl subroutine that reads in a file containing two strings on each line and creates a hash with the first

What is the purpose of using javascript on a website what : what is the purpose of using javascript on a website? what is a specific example of a javascript application that will

Explain how architecting systems provide a means to deliver : the article is an overview of the topic of software architecture and contains several brief case studies in chapter 4.

How does cognitive psychology assist you to understand : how does cognitive psychology help you to understand memory? how can the accuracy of memory be affected by cognitive

Write down a perl program that given a dna string prints : write a perl program that given a dna string prints out the 20 characters upstream of the start codon atg. that is

A group of researchers performed the experiment to find out : a group of researchers conducted an experiment to determine which vaccine is more effective for preventing getting the

Based on your performance abs management was so satisfied : refer to the functional model you verified and validated for abs in the week 4 assignment to complete this

The module review questions listed below these questions : 1.answer the module review questions listed below. these questions were chosen to demonstrate your understanding and

What are production-planning strategies and how might you : 1.what are production-planning strategies and how might you incorporate them into your daily activities? which strategy

User Account

All Pages