Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Problem:
Recombinant DNA molecules are DNA molecules formed by laboratory methods of genetic recombination to bring together genetic material from multiple sources, creating sequences that would not otherwise be found. The letters C, G, A, and T represent nucleotides, the molecules that when joined together, make up the structural units of DNA. Simulate an experiment by searching for the pattern "GAATTC ". Your code will search for "GAATTC " in the original DNA strand, which is "CTAGAGAATTCCTGA" below. Split that strand into two pieces and place the new DNA, which is "TGATA" below, into the original strand. The new strand should be inserted before the strand being searched for, "GAATTC", to increase the original strand. The user must enter the original strand, the new strand to be inserted, and the sequence to be searched for. Your dialog must look like this, with three inputs and the longer strand as the output:
Original: CTAGAGAATTCCTGA
New: TGATA
Search: GAATTC
Increased: CTAGATGATAGAATTCCTGA
Hints:
Write a class Array that encapsulates an array and provides bounds-checked access. Create a recursive factorial program that prompts the user for an integer N and writes out a series of equations representing the calculation of N!.
Reprot on Hunt the Wumpus Game has Source Code listing, screen captures and UML design here and also, may include Javadoc source here.
Create GUI Interface in java programing with these function: Sort by last name and print all employees info, Sort by job title and print all employees info, Sort by weekly salary and print all employees info, search by job title and print that emp..
Write a JAVA program that would get the locations of all the POIs from the file and plot them on a map.
University grading system maintains number of tables to store, retrieve and manipulate student marks. Write a JAVA program that would simulate a number of cars.
This project is designed a game in java. you choose whether you'd like to write a wolf or a sheep agent. Then, you are assigned to either a "sheep" or a "wolf" team.
Build a graphical user interface for displaying the image groups (= cluster) in JMJRST. Design and implement using a Swing interface.
This assignment contains a java project. Project evaluates the day of the week for New Year's Day.
Write a Java windowed application to do online quiz on general knowledge and the application also displays the quiz result.
Java program to input pairs of natural numbers.
Interface that contains a generic type. Create two classes that implement this interface.
These 14 questions covers java class, Array, link list , generic class.
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd