Find what was the standard materials quantity per unit

Assignment Help Managerial Accounting
Reference no: EM132553043

Crede Manufacturing Company uses a standard cost accounting system. In 2020, 26,000 units were produced. Each unit took several kilograms of direct materials and 1.6 standard hours of direct labour at a standard hourly rate of $9. Normal capacity was 50,900 direct labour hours. During the year, 117,000 kg of raw materials were purchased at $0.95 per kilogram. All materials purchased were used during the year.

Question 1: If the materials quantity variance was $5,200 unfavourable, what was the standard materials quantity per unit? (Round answer to 2 decimal places, e.g. 5.17.)

Reference no: EM132553043

Questions Cloud

Determine yux monthly break-even point in units : Assuming fixed costs and net sales are spread evenly throughout the year, determine YUX's monthly break-even point in units and dollars.
SITXMGT002 Establish and conduct business relationships : SITXMGT002 Establish and conduct business relationships Assignment Help and Solution, Mastery Institute Australia - Assessment Writing Service
Overall humoral immunity to pathogens : Antibodies come in many different isotypes in which they differ in structure, distribution in the body, and their effector mechanisms.
Lots of naïve cd4 and cd8 t cells : The body produces lots and lots of naïve CD4 and CD8 T cells that spend most of their time circulating the body doing nothing but each having the potential
Find what was the standard materials quantity per unit : Crede Manufacturing Company uses a standard, Find what was the standard materials quantity per unit? (Round answer to 2 decimal places, e.g. 5.17.)
KF7031 Wireless Networks and Security Assignment : KF7031 Wireless Networks and Security Assignment Help and Solution - Northumbria University - Assessment Writing Service - What is Multipath in RF transmission
Calculate the unit cost of each of the three speedboat model : Calculate the unit cost of each of the three speedboat models using the proposed activity-based costing system of allocating overhead.
Determining the type of mutation : If you don't have a partner use this sequence to answer #1: TACTAACTATTATAGGCCGTATGGATC Have your partner introduce a point mutation
Urinary tract infections : What are the three ways in which urinary tract infections may be acquired? What are the primary and secondary antibody responses to an immunogenic response.

Reviews

Write a Review

Managerial Accounting Questions & Answers

  Manage budgets and financial plans

Explain the budgeting process and its importance to a business, identifying the components of different budgets, forecast estimates for inclusion in the budgets.

  Prepare a retained earnings statement

Prepare a retained earnings statement for the year and Prepare a stockholders' equity section of given case.

  Prepare a master budget for the three-month period

Prepare a master budget for the three-month period.

  Construct the companys direct labor budget

Construct the company's direct labor budget for the upcoming fiscal year, assuming that the direct labor workforce is adjusted each quarter to match the number of hours required to produce the forecasted number of units produced.

  Evaluate the predetermined overhead rate

Evaluate the Predetermined Overhead Rate

  Determine the company''s bid

Determine the company's bid if activity-based costing is used and the bid is based upon full manufacturing cost plus 30 percent.

  Compute the pool rates for the different activities

Complete the schedule to compute the pool rates for the different activities.

  Prepare Company financial statements

Prepare Company financial statements

  Prepare an analysis of terracycles

This individual assignment is based on the TerraCycle Inc.

  Discuss the ethical issues

Discuss the ethical issues

  Political resources in emerging markets

Calculate the GDP in Income Approach  and Expenditure Approach

  Management accounting - ehsan electronics company

A new plant accountant suggested that the company may be able to assign support costs to products more accurately by using an activity based costing system that relies on a separate rate for each manufacturing activity that causes support costs.

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd