Determine how many times a occurs in the dna string

Assignment Help Computer Engineering

Reference no: EM132142040

Question :

Suppose we are interested in studying a DNA sequence which consists of four bases: A, C, G, and T.

Write a program that does the following: Create a random DNA string of length 50.

Determine how many times A occurs in the DNA string. Create a dot string which blanks out everything but all the A characters.

Create a rep string where everything is blanked out except where A repeats 1 or more times. Prints the results as follows:

DNA: TGAAAACTACCACATCATGCAGTTTTCAAAGAAGAAAGCCTCACCACAAA

dotStr:.. AAAA. .A..A.A. .A...A...... AAA.AA.AAA.....A..A.AAA

repStr:. AAAA.....................AAA.AA.AAA.........AAA

#A: 22

Reference no: EM132142040

Questions Cloud

What endowment must the donor make now : The scholarship is to provide $10,000 per year. On the assumption that the scholarship will start at the end of the first year and continue forever.

Find the maximum possible number of tuples in the relation : Suppose that P(A, B, C), Q(A, C), R(B) are relations such that P contains 6 tuples, Q contains 2 tuples and R contains 3 tuples.

What is the the real economic growth rate : Assume that wages and prices are sticky and that we start at a long-run equilibrium. Assume that at this initial point, the growth rate of the money supply.

Plot the yield curve and describe the general shape of curve : 25721 Investment Management Assignment, UTS Business School, Australia. plot the yield curve and describe the general shape of curve

Determine how many times a occurs in the dna string : Determine how many times A occurs in the DNA string. Create a dot string which blanks out everything but all the A characters.

Draw a graph of the us automobile market : Draw a graph of the U.S automobile market in which the domestic equilibrium price without trade is Pd and the and the equilibrium quantity is Qd.

Explain the difference between the two diagrams : Draw the supply and demand diagram for reserves with the curves intersecting on the downward sloping part of the demand curve - diagram A.

How many database requests can you identify : Suppose you are a manufacturer of product ABC, which is composed of components A, B, and C. Component A is further composed of parts X and Y.

Differences of blue ocean and red ocean strategies : Explain the characteristics and fundamental differences of ‘Blue Ocean and Red Ocean’ strategies (Kim & Mauborgne, 2005).

User Account

All Pages