Change in the protein synthesized

Assignment Help Business Management
Reference no: EM132553200

Based on the following information:

a. DNA template card #5:

DNA: TACCTTTGTACCATATCTATT

mRNA: AUGGAAACAUGGUAUAGAUAA

Codon: AUG-GAA-ACA-UGG-UAU-AGA-UAA

Amino Acid Sequence: Met-Glu-Thr-Trp-Tyr-Arg-Stop

b. DNA template card # 11:

DNA: TACCTGTGTACCATATCTATT

mRNA: AUGGACACAUGGUAUAGAUAA

Codon: AUG-GAC-ACA-UGG-UAU-AGA-UAA

Amino Acid Sequence: Met-Asp-Thr-Trp-Tyr-Arg-Stop

c. DNA template card # 12:

DNA: TAC-CAT-GTA-CCA-TAT-CTA-CT

mRNA: AUG-GUA-CAU-GGU-AUA-GAU-GA

Codon: AUG-GUA-CAU-GGU-AUA-GAU-GA

Amino Acid Sequence: Met-Val-His-Gly-Ile-Asp

d. DNA template card # 13:

DNA: TACCCTTTGTACCATATCTACT

mRNA: AUGGGAAACAUGGUAUAGAUGA

Codon: AUG-GGA-AAC-AUG-GUA-UAG-AUG-A

Amino Acid Sequence: Met-Gly-Asn-Met-Val-Stop

e. DNA template card # 14:

DNA: TACTTTGTACCATATCTATC

mRNA: AUGAAACAUGGUAUAGAUAG

Codon: AUG-AAA-CAU-GGU-AUA-GAU-AG

Amino Acid Sequence: Met-Lys-His-Gly-Ile-Asp

Answer these questions:

a. Did the mutation in card 11 result in a change in the protein synthesized?

b. Did the mutation in card 12 result in a change in the protein synthesized?

c. What type of mutation occurred in cards 13 and 14?

d. Would the mutations that occurred in cards 13 and 14 result in a change in the protein synthesized?

Reference no: EM132553200

Questions Cloud

Determine return on investment was : For 2025, Aberdeen's return on sales was 10% and its investment turnover was 2.0. What Return on investment for 2025 was?
What does muscular function have to do with sense of vision : 1. What does muscular function have to do with the sense of vision? 2. In what way is the structure of the ear similar to that of the eye?
List 4 functions for proteins : What would happen if you gave a patient an IV of pure water? In which way would the water be moving?
What a transfer of products between two divisions should : What a transfer of products between two divisions should take place if it?increases awareness within the company of activity in the various divisions.
Change in the protein synthesized : Would the mutations that occurred in cards 13 and 14 result in a change in the protein synthesized?
What was the st john division eva : What was the St. John's Division EVA for 2022? St. John's Division has a required rate of return of 15%. The weighted average cost of capital
Identify the characteristics of hypoglycemia : A 25-year-old healthy female patient complained of dizziness and shaking 1 hour after eating a large, heavy-carbohydrate meal.
Estimate the allowance for bad debts : Describe each method used to estimate the allowance for bad debts. Do you think business employ the methods described in the text and why?
Compute the overhead cost per unit for each product : Compute the overhead cost per unit for each product under the proposed activity based costing. Production is 400,000 units of Standard

Reviews

Write a Review

Business Management Questions & Answers

  Caselet on michael porter’s value chain management

The assignment in management is a two part assignment dealing 1.Theory of function of management. 2. Operations and Controlling.

  Mountain man brewing company

Mountain Man Brewing, a family owned business where Chris Prangel, the son of the president joins. Due to increase in the preference for light beer drinkers, Chris Prangel wants to introduce light beer version in Mountain Man. An analysis into the la..

  Mountain man brewing company

Mountain Man Brewing, a family owned business where Chris Prangel, the son of the president joins. An analysis into the launch of Mountain Man Light over the present Mountain Man Lager.

  Analysis of the case using the doing ethics technique

Analysis of the case using the Doing Ethics Technique (DET). Analysis of the ethical issue(s) from the perspective of an ICT professional, using the ACS Code of  Conduct and properly relating clauses from the ACS Code of Conduct to the ethical issue.

  Affiliations and partnerships

Affiliations and partnerships are frequently used to reach a larger local audience? Which options stand to avail for the Hotel manager and what problems do these pose.

  Innovation-friendly regulations

What influence (if any) can organizations exercise to encourage ‘innovation-friendly' regulations?

  Effect of regional and corporate cultural issues

Present your findings as a group powerpoint with an audio file. In addition individually write up your own conclusions as to the effects of regional cultural issues on the corporate organisational culture of this multinational company as it conducts ..

  Structure of business plan

This assignment shows a structure of business plan. The task is to write a business plane about a Diet Shop.

  Identify the purposes of different types of organisations

Identify the purposes of different types of organisations.

  Entrepreneur case study for analysis

Entrepreneur Case Study for Analysis. Analyze Robin Wolaner's suitability to be an entrepreneur

  Forecasting and business analysis

This problem requires you to apply your cross-sectional analysis skills to a real cross-sectional data set with the goal of answering a specific research question.

  Educational instructional leadership

Prepare a major handout on the key principles of instructional leadership

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd