Unilateral incompatibility, Biology

Unilateral Incompatibility

This relates to incompatibility that operates in one direction. The most common way to ascertain unilateral incompatibility is to perform crosses between a self-incompatible species and a self-compatible species. The cross is successful only when the self-compatible species serves as the female parent. This kind of incompatibility also operates between species of different genera. Unilateral incompatibility can be explained on the following basis:

Table:  Inter specific incompatibility - Passive rejection and possible mechanisms

818_Unilateral Incompatibility.png

Posted Date: 1/23/2013 5:30:19 AM | Location : United States







Related Discussions:- Unilateral incompatibility, Assignment Help, Ask Question on Unilateral incompatibility, Get Answer, Expert's Help, Unilateral incompatibility Discussions

Write discussion on Unilateral incompatibility
Your posts are moderated
Related Questions
Starch gelatinization Undamaged starch granules are insoluble in cold water but can imbibe water  reversibly i.e. they can swell slightly and then return to their original siz

Q. How are bacteria are classified according to their need for oxygen? According to their need of oxygen bacteria are classified into anaerobic those that survive without oxyge

What is Density-dependent and density-independent Factors? Density-dependent : Ecologists identify population-regulating mechanisms whose functioning is related to density a

what is surrogate motherhood

What is Deuterostome. Explain in brief. Phyla, including the Chordata and Echinodermata which share common characteristics of blastopore-not forming the mouth, radial indetermi

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Determine the types of symbols used in Soil Horizons  Three kinds of symbols are used in various combinations to designate horizons. These are capital letters, lower case lett

Phases of viruses Viruses have two phases to their existence Inside their host cells where they exhibit certain living characteristics. outside their host where they

Specific Guidelines Physician's orders Each order should have the date and time it was written.  Some way of indicating which orders have been carried out is nece

The Intine Layer As soon as the tetrads release the microspores, the inner layer of the pollen wall (intine) is formed. Proteinaceous lamellae are embedded in the matrix of th