The cell body of the toe motor neuron, Biology

Assignment Help:

Which of the following is true for a toe motor neuron that excites a toe muscle that moves the big toe in the left foot?

A. All of the axon terminals of the toe motor neuron are located in the left half of the spinal cord.

B. The cell body of the toe motor neuron is located in the left half of the spinal cord.

C. Some of the axon of the toe motor neuron is located in a peripheral nerve in the left leg.

 


Related Discussions:- The cell body of the toe motor neuron

Define rheology and syneresis, Define Rheology and syneresis Rheology:...

Define Rheology and syneresis Rheology:   the science of the deformation and flow of matter. It is the branch of physics concerned with the flow and change of shape of matter,

Membrane perforation of sinus graft surgery, Membrane Perforation of sinus ...

Membrane Perforation of sinus graft surgery it is the most common complication during the sinus graft surgery resulting from the scoring of lateral access window for surgery an

Cells, #question.why are active cells small .

#question.why are active cells small .

Enumerate about the traumatic brain injuries, Enumerate about the Traumatic...

Enumerate about the Traumatic brain injuries Brain injury is a common result of automobile and industrial accidents and of war injuries. Brain injury can affect brain function

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

The emergency department due to the babys persistent, A mother has brought ...

A mother has brought her 2-week-old infant to the emergency department due to the baby's persistent and increasing jaundice. Blood testing reveals that the infant's unconjugated bi

What are non-threshold approaches, Non-threshold  approaches For  gene...

Non-threshold  approaches For  genetic carcinogenes, the  "NOEL-safety factor"  approach  is generally  not considered a suitable method for setting the acceptable intake level

Stomata - water loss, Stomata - Water Loss The cross-section of a leaf...

Stomata - Water Loss The cross-section of a leaf shown in Figure shows the position of a typical stoma (plural stomata) which however, differs from species to species, with re

Explain atrial switch operation, Explain Atrial Switch Operation ? The ...

Explain Atrial Switch Operation ? The hospital mortality reported varies between 0 and 15 per cent. Late survival is worse for TGA with VSD compared to simple TGA. 15 year surv

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd