Simple precautions to prevent injuries, Biology

When resheathing needles, simple precautions to prevent injuries are to:

1. use only one hand to scoop the cap

2. hold the sheath with a hemostat (suggested but will require hemostat with each procedure that requires anesthetic)

3. use a special plastic or disposable device that slips onto the sheath to protect fingers during resheathing (not available at the Faculty)

4. use a syringe stand, in which the sheath is held tightly within the stand, allowing the needle to be withdrawn and placed back into the sheath with one hand.

Do NOT pass sharp instruments or corrosive liquids over the patients' face. We have talked in detail about sterilization and infection control and as part of the operatory protocol. One last main aspect of operatory protocol is the management of wastes generated in the operatory.

Posted Date: 7/27/2013 5:20:55 AM | Location : United States







Related Discussions:- Simple precautions to prevent injuries, Assignment Help, Ask Question on Simple precautions to prevent injuries, Get Answer, Expert's Help, Simple precautions to prevent injuries Discussions

Write discussion on Simple precautions to prevent injuries
Your posts are moderated
Related Questions
What is visual accommodation? Visual accommodation is the phenomenon of varying the curvature of the crystalline lens to make possible the variation of its refractivity to adju

Which is the typical feature of the hookworms related to the way they obtain food and explore the host? Both Ancylostoma duodenale and Necator americanus have mouthparts with h

Explain the Bioelectrical impedance Analysis (BIA)? The difficulty of measuring total body water (TBW) by Isotope Dilution Method led to the search of Bioelectrical Impedance A

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

difference btn massflow and pressure law

Eutrophication - Effect on Water Bodies Moderate quantities of sewage decay naturally in a water body and water gets purified after some time. But the problem arises when the


Q. How is digestion performed in protozoans? Digestion in protozoans is intracellular digestion organic material degraded inside the cell and is internalized. Protozoans get

Explain Nutritional Support Management for radiation therapy? For managing these patients on radiation therapy, the following measures can be under taken: 1. Administration

How come that difference of K+ and Na+, which are both monovalent cations, creates the difference of the net charge of the membrane at different sides?