Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Peptide bond formation is catalyzed by peptidyl transferase. The carboxyl end of the amino acid bound to the tRNA in this reaction and in the P site is uncoupled from the tRNA and becomes joined by a peptide bond to the amino set of the amino acid connect to the tRNA in the A site. A protein with peptidyl transferase activity has certainly not been isolated. The reason is now obvious; in E. coli at least, the peptidyl transfers activity is related with part of the 23S rRNA in the vast ribosomal subunit. Alternatively, peptidyl transferase is a ribozyme, a catalytic activity which resides in an RNA molecule.
Biopathways 1. Find out pathway information about these proteins using the Human Reactome. O00327 O14503 O75586 O95096 P01137 P01308 P06744 P08240 P12
complement system
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Enumerate in detail about the Cytoskeleton All eukaryotic cells have distinct shapes, and are also capable of assuming different shapes. 'The internal organelles of a cell are
ExplainTransketolase Transketolase with the help of TPP and Mg ++ is required again. This time it transfers carbon 1+2 from xylulose-5-phosphate to erythrose-4-phospha
What is the relationship among environmental resistance and the population growth according to the biotic potential curve and the real population growth curve? The difference
Explain Asystole and Pulseless Electrical Activity (PEA) The outcomes from these rhythms are generally much worse than for VT/VF, unless a readily correctable cause is identif
HEAR T - The cells called cardiocytes of atria of the heart secrete peptide hormone called atrial natriuretic factor (ANF) in response of an increased return of the deoxygen
How does the amoeboid movement occur? What are examples of beings and cells that use such movements for locomotion? Amoeboid movements are formed by cytoplasmic movements and p
is mismatch repair something different from proofreading?
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +1-415-670-9521
Phone: +1-415-670-9521
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd