microbiology, Biology


2. Vaccinations against various childhood
diseases have contributed to the entry of
women, particularly mothers, into the fulltime
workplace.
a. Is this statement supported by data—
comparing availability and extent of
vaccination with employment statistics
in different places or at different
times?
b. Before vaccinations for measles, mumps,
and chickenpox, what was the incubation
time and duration of these childhood
diseases? What impact would such diseases
have on mothers with several elementary
schoolchildren at home if they had fulltime
jobs and lacked substantial child care
support?
c. What would be the consequence if an entire
generation of children (or a group of
children in one country) were not vaccinated
against any diseases? What do you predict
would happen if these children went to
college and lived in a dormitory in close
proximity with others who had received all
of the recommended childhood vaccines?
Posted Date: 2/7/2013 5:44:36 PM | Location : United States







Related Discussions:- microbiology, Assignment Help, Ask Question on microbiology, Get Answer, Expert's Help, microbiology Discussions

Write discussion on microbiology
Your posts are moderated
Related Questions
Which of the following cells of the immune system is most likely to be directly involved in the rejection of a transplant? Answer plasma cells eosinophils basophils T lymphocytes m

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT


Q. What is Alzheimer's disease? The Alzheimer's disease is a degenerative disease of the central nervous system in which the patient has progressive dementia and alteration of

Response to Heavy Metal Stress Several heavy metals emanating from industrial mining and sewage disposal operations contaminate the environment. Cadmium is a common contamina

What is the role of Linked Traits in genetics? In his study of inheritance in the fruit fly, Morgan observed that certain genes are distributed together, or linked, rather than

Define Recommended Intake of Fibre? 1. A minimum of fibre intake of 20 g/day is recommended by the American Dietetic Association (ADA), the National Cancer Institute, US and th


M a g n etic resonance imaging (MRI): It is in use as a clinical diagnostic tool since 1980. The distribution of hydrogen nuclei (protons), present in cellular wa

Q. How are antivenoms produced? Why are antivenoms an example of passive immunization? Antivenoms are obtained by the following process: the venom (antigen) is inoculated into