Incomplete digestive and a complete digestive system system, Biology

Q What is the difference between an incomplete digestive and a complete digestive system system? How are these types of digestive tubes associated or not to extracellular digestion?

Animals with an incomplete digestive system are those in which the digestive tube has only one opening platyhelminthes, cnidarians. Animals with a complete digestive system are those in which the digestive tube has two openings, anus and mouth all other animal phyla, with the exception of poriferans, that do not have any digestive tube.

In animals with incomplete digestive tubes the digestion is mixed it begins in the extracellular finishes and space in the intracellular space, in animals with complete digestive systems extracellular digestion within the digestive tube predominates.

Posted Date: 6/3/2013 3:35:55 AM | Location : United States







Related Discussions:- Incomplete digestive and a complete digestive system system, Assignment Help, Ask Question on Incomplete digestive and a complete digestive system system, Get Answer, Expert's Help, Incomplete digestive and a complete digestive system system Discussions

Write discussion on Incomplete digestive and a complete digestive system system
Your posts are moderated
Related Questions
why are the microspores in groups of four?

Open Style - Style of Stigma Interaction Aegle, Fritillaria, Lilium spp. have variable number of stylar canals depending on the number of carpels. The epidermal cells of styla

Pulmonary Ventilation: Pulmonary ventilation is the process by which gasses flow between the atmosphere and lung alveoli. Air moves into the  lungs when air pressure  inside the

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Suppose that the type of drink did not affect which can floated or sank. May be the cans themselves were different in some way. May be something besides soda got into one of the ca

Light Requirement - Seed Dormancy The light requirement for germination of many seeds is presumably a mechanism that prevents the germination of small seeds buried deep underg

Explain the Catabolic Responses? Hormonal responses during the hyper inetabolic phase of infection are same as in case of injury. Serum cortisol levels are elevated, glycogen i

What are primary consumers? Can a food chain present quaternary consumers without having secondary or tertiary consumers? Can a tertiary consumer of one chain be a primary or secon

In vivo imaging in psychiatry To illustrate the ingenious applications to which in vivo imaging can be put, consider the use of PET in the study of hallucinations by Frith and

Hypoglycaemia Unawareness ? Some people with diabetes do not have early warning signs of low blood glucose, a condition called hypoglycemia unawareness. ? This conditio